ID: 1069650357

View in Genome Browser
Species Human (GRCh38)
Location 10:70042761-70042783
Sequence CCAGGGCATACACTGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069650357_1069650374 30 Left 1069650357 10:70042761-70042783 CCCCAGGGCAGTGTATGCCCTGG No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650357_1069650366 3 Left 1069650357 10:70042761-70042783 CCCCAGGGCAGTGTATGCCCTGG No data
Right 1069650366 10:70042787-70042809 ACTACCCTCAGATCCCCCAAGGG No data
1069650357_1069650369 14 Left 1069650357 10:70042761-70042783 CCCCAGGGCAGTGTATGCCCTGG No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650357_1069650365 2 Left 1069650357 10:70042761-70042783 CCCCAGGGCAGTGTATGCCCTGG No data
Right 1069650365 10:70042786-70042808 CACTACCCTCAGATCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069650357 Original CRISPR CCAGGGCATACACTGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr