ID: 1069650359

View in Genome Browser
Species Human (GRCh38)
Location 10:70042762-70042784
Sequence GCCAGGGCATACACTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069650359_1069650369 13 Left 1069650359 10:70042762-70042784 CCCAGGGCAGTGTATGCCCTGGC No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650359_1069650365 1 Left 1069650359 10:70042762-70042784 CCCAGGGCAGTGTATGCCCTGGC No data
Right 1069650365 10:70042786-70042808 CACTACCCTCAGATCCCCCAAGG No data
1069650359_1069650374 29 Left 1069650359 10:70042762-70042784 CCCAGGGCAGTGTATGCCCTGGC No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650359_1069650366 2 Left 1069650359 10:70042762-70042784 CCCAGGGCAGTGTATGCCCTGGC No data
Right 1069650366 10:70042787-70042809 ACTACCCTCAGATCCCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069650359 Original CRISPR GCCAGGGCATACACTGCCCT GGG (reversed) Intergenic
No off target data available for this crispr