ID: 1069650363

View in Genome Browser
Species Human (GRCh38)
Location 10:70042784-70042806
Sequence TTGGGGGATCTGAGGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069650363_1069650369 -9 Left 1069650363 10:70042784-70042806 CCCACTACCCTCAGATCCCCCAA No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650363_1069650374 7 Left 1069650363 10:70042784-70042806 CCCACTACCCTCAGATCCCCCAA No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650363_1069650375 12 Left 1069650363 10:70042784-70042806 CCCACTACCCTCAGATCCCCCAA No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650363_1069650378 16 Left 1069650363 10:70042784-70042806 CCCACTACCCTCAGATCCCCCAA No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069650363 Original CRISPR TTGGGGGATCTGAGGGTAGT GGG (reversed) Intergenic
No off target data available for this crispr