ID: 1069650367

View in Genome Browser
Species Human (GRCh38)
Location 10:70042791-70042813
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069650367_1069650374 0 Left 1069650367 10:70042791-70042813 CCCTCAGATCCCCCAAGGGCTGA No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650367_1069650375 5 Left 1069650367 10:70042791-70042813 CCCTCAGATCCCCCAAGGGCTGA No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650367_1069650378 9 Left 1069650367 10:70042791-70042813 CCCTCAGATCCCCCAAGGGCTGA No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069650367 Original CRISPR TCAGCCCTTGGGGGATCTGA GGG (reversed) Intergenic
No off target data available for this crispr