ID: 1069650369

View in Genome Browser
Species Human (GRCh38)
Location 10:70042798-70042820
Sequence ATCCCCCAAGGGCTGAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069650354_1069650369 28 Left 1069650354 10:70042747-70042769 CCTATCCATGCAGCCCCCAGGGC No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650355_1069650369 23 Left 1069650355 10:70042752-70042774 CCATGCAGCCCCCAGGGCAGTGT No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650360_1069650369 12 Left 1069650360 10:70042763-70042785 CCAGGGCAGTGTATGCCCTGGCC No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650364_1069650369 -10 Left 1069650364 10:70042785-70042807 CCACTACCCTCAGATCCCCCAAG No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650356_1069650369 15 Left 1069650356 10:70042760-70042782 CCCCCAGGGCAGTGTATGCCCTG No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650357_1069650369 14 Left 1069650357 10:70042761-70042783 CCCCAGGGCAGTGTATGCCCTGG No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650362_1069650369 -4 Left 1069650362 10:70042779-70042801 CCTGGCCCACTACCCTCAGATCC No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650359_1069650369 13 Left 1069650359 10:70042762-70042784 CCCAGGGCAGTGTATGCCCTGGC No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650363_1069650369 -9 Left 1069650363 10:70042784-70042806 CCCACTACCCTCAGATCCCCCAA No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data
1069650361_1069650369 -3 Left 1069650361 10:70042778-70042800 CCCTGGCCCACTACCCTCAGATC No data
Right 1069650369 10:70042798-70042820 ATCCCCCAAGGGCTGAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069650369 Original CRISPR ATCCCCCAAGGGCTGAGCTG AGG Intergenic
No off target data available for this crispr