ID: 1069650374

View in Genome Browser
Species Human (GRCh38)
Location 10:70042814-70042836
Sequence GCTGAGGCCCAGACCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069650368_1069650374 -1 Left 1069650368 10:70042792-70042814 CCTCAGATCCCCCAAGGGCTGAG No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650367_1069650374 0 Left 1069650367 10:70042791-70042813 CCCTCAGATCCCCCAAGGGCTGA No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650362_1069650374 12 Left 1069650362 10:70042779-70042801 CCTGGCCCACTACCCTCAGATCC No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650364_1069650374 6 Left 1069650364 10:70042785-70042807 CCACTACCCTCAGATCCCCCAAG No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650371_1069650374 -10 Left 1069650371 10:70042801-70042823 CCCCAAGGGCTGAGCTGAGGCCC No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650370_1069650374 -9 Left 1069650370 10:70042800-70042822 CCCCCAAGGGCTGAGCTGAGGCC No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650360_1069650374 28 Left 1069650360 10:70042763-70042785 CCAGGGCAGTGTATGCCCTGGCC No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650359_1069650374 29 Left 1069650359 10:70042762-70042784 CCCAGGGCAGTGTATGCCCTGGC No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650357_1069650374 30 Left 1069650357 10:70042761-70042783 CCCCAGGGCAGTGTATGCCCTGG No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650363_1069650374 7 Left 1069650363 10:70042784-70042806 CCCACTACCCTCAGATCCCCCAA No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data
1069650361_1069650374 13 Left 1069650361 10:70042778-70042800 CCCTGGCCCACTACCCTCAGATC No data
Right 1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069650374 Original CRISPR GCTGAGGCCCAGACCCCAGA TGG Intergenic
No off target data available for this crispr