ID: 1069650375

View in Genome Browser
Species Human (GRCh38)
Location 10:70042819-70042841
Sequence GGCCCAGACCCCAGATGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069650364_1069650375 11 Left 1069650364 10:70042785-70042807 CCACTACCCTCAGATCCCCCAAG No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650367_1069650375 5 Left 1069650367 10:70042791-70042813 CCCTCAGATCCCCCAAGGGCTGA No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650373_1069650375 -7 Left 1069650373 10:70042803-70042825 CCAAGGGCTGAGCTGAGGCCCAG No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650362_1069650375 17 Left 1069650362 10:70042779-70042801 CCTGGCCCACTACCCTCAGATCC No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650370_1069650375 -4 Left 1069650370 10:70042800-70042822 CCCCCAAGGGCTGAGCTGAGGCC No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650372_1069650375 -6 Left 1069650372 10:70042802-70042824 CCCAAGGGCTGAGCTGAGGCCCA No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650363_1069650375 12 Left 1069650363 10:70042784-70042806 CCCACTACCCTCAGATCCCCCAA No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650361_1069650375 18 Left 1069650361 10:70042778-70042800 CCCTGGCCCACTACCCTCAGATC No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650368_1069650375 4 Left 1069650368 10:70042792-70042814 CCTCAGATCCCCCAAGGGCTGAG No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data
1069650371_1069650375 -5 Left 1069650371 10:70042801-70042823 CCCCAAGGGCTGAGCTGAGGCCC No data
Right 1069650375 10:70042819-70042841 GGCCCAGACCCCAGATGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069650375 Original CRISPR GGCCCAGACCCCAGATGGAA AGG Intergenic
No off target data available for this crispr