ID: 1069650378

View in Genome Browser
Species Human (GRCh38)
Location 10:70042823-70042845
Sequence CAGACCCCAGATGGAAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069650368_1069650378 8 Left 1069650368 10:70042792-70042814 CCTCAGATCCCCCAAGGGCTGAG No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650362_1069650378 21 Left 1069650362 10:70042779-70042801 CCTGGCCCACTACCCTCAGATCC No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650370_1069650378 0 Left 1069650370 10:70042800-70042822 CCCCCAAGGGCTGAGCTGAGGCC No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650371_1069650378 -1 Left 1069650371 10:70042801-70042823 CCCCAAGGGCTGAGCTGAGGCCC No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650361_1069650378 22 Left 1069650361 10:70042778-70042800 CCCTGGCCCACTACCCTCAGATC No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650364_1069650378 15 Left 1069650364 10:70042785-70042807 CCACTACCCTCAGATCCCCCAAG No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650372_1069650378 -2 Left 1069650372 10:70042802-70042824 CCCAAGGGCTGAGCTGAGGCCCA No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650373_1069650378 -3 Left 1069650373 10:70042803-70042825 CCAAGGGCTGAGCTGAGGCCCAG No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650363_1069650378 16 Left 1069650363 10:70042784-70042806 CCCACTACCCTCAGATCCCCCAA No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data
1069650367_1069650378 9 Left 1069650367 10:70042791-70042813 CCCTCAGATCCCCCAAGGGCTGA No data
Right 1069650378 10:70042823-70042845 CAGACCCCAGATGGAAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069650378 Original CRISPR CAGACCCCAGATGGAAAGGT TGG Intergenic
No off target data available for this crispr