ID: 1069651704

View in Genome Browser
Species Human (GRCh38)
Location 10:70053717-70053739
Sequence GGTTCCCTTTCCGGGGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069651691_1069651704 22 Left 1069651691 10:70053672-70053694 CCGGGGCCGGCGCGGAAGAGGGC No data
Right 1069651704 10:70053717-70053739 GGTTCCCTTTCCGGGGCGCCCGG No data
1069651697_1069651704 -7 Left 1069651697 10:70053701-70053723 CCGGGCACTCCCCTTCGGTTCCC No data
Right 1069651704 10:70053717-70053739 GGTTCCCTTTCCGGGGCGCCCGG No data
1069651689_1069651704 23 Left 1069651689 10:70053671-70053693 CCCGGGGCCGGCGCGGAAGAGGG No data
Right 1069651704 10:70053717-70053739 GGTTCCCTTTCCGGGGCGCCCGG No data
1069651692_1069651704 16 Left 1069651692 10:70053678-70053700 CCGGCGCGGAAGAGGGCGCGAGG No data
Right 1069651704 10:70053717-70053739 GGTTCCCTTTCCGGGGCGCCCGG No data
1069651687_1069651704 24 Left 1069651687 10:70053670-70053692 CCCCGGGGCCGGCGCGGAAGAGG No data
Right 1069651704 10:70053717-70053739 GGTTCCCTTTCCGGGGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069651704 Original CRISPR GGTTCCCTTTCCGGGGCGCC CGG Intronic