ID: 1069658834 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:70110034-70110056 |
| Sequence | CTGTAATCACACATCAACCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069658829_1069658834 | 10 | Left | 1069658829 | 10:70110001-70110023 | CCCAAGAGGAAAATAATGAGACC | 0: 1 1: 0 2: 3 3: 18 4: 292 |
||
| Right | 1069658834 | 10:70110034-70110056 | CTGTAATCACACATCAACCTAGG | No data | ||||
| 1069658830_1069658834 | 9 | Left | 1069658830 | 10:70110002-70110024 | CCAAGAGGAAAATAATGAGACCT | 0: 1 1: 0 2: 1 3: 32 4: 355 |
||
| Right | 1069658834 | 10:70110034-70110056 | CTGTAATCACACATCAACCTAGG | No data | ||||
| 1069658828_1069658834 | 19 | Left | 1069658828 | 10:70109992-70110014 | CCTGGGAAGCCCAAGAGGAAAAT | 0: 1 1: 0 2: 0 3: 32 4: 294 |
||
| Right | 1069658834 | 10:70110034-70110056 | CTGTAATCACACATCAACCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069658834 | Original CRISPR | CTGTAATCACACATCAACCT AGG | Intronic | ||
| No off target data available for this crispr | |||||