ID: 1069658834

View in Genome Browser
Species Human (GRCh38)
Location 10:70110034-70110056
Sequence CTGTAATCACACATCAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069658829_1069658834 10 Left 1069658829 10:70110001-70110023 CCCAAGAGGAAAATAATGAGACC 0: 1
1: 0
2: 3
3: 18
4: 292
Right 1069658834 10:70110034-70110056 CTGTAATCACACATCAACCTAGG No data
1069658830_1069658834 9 Left 1069658830 10:70110002-70110024 CCAAGAGGAAAATAATGAGACCT 0: 1
1: 0
2: 1
3: 32
4: 355
Right 1069658834 10:70110034-70110056 CTGTAATCACACATCAACCTAGG No data
1069658828_1069658834 19 Left 1069658828 10:70109992-70110014 CCTGGGAAGCCCAAGAGGAAAAT 0: 1
1: 0
2: 0
3: 32
4: 294
Right 1069658834 10:70110034-70110056 CTGTAATCACACATCAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069658834 Original CRISPR CTGTAATCACACATCAACCT AGG Intronic
No off target data available for this crispr