ID: 1069664151

View in Genome Browser
Species Human (GRCh38)
Location 10:70143841-70143863
Sequence CCCGCTGAGCACTTCCATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069664151_1069664159 14 Left 1069664151 10:70143841-70143863 CCTTCATGGAAGTGCTCAGCGGG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1069664159 10:70143878-70143900 CATCATCCAGGTCCTCCTCCAGG 0: 1
1: 0
2: 2
3: 32
4: 291
1069664151_1069664157 -10 Left 1069664151 10:70143841-70143863 CCTTCATGGAAGTGCTCAGCGGG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1069664157 10:70143854-70143876 GCTCAGCGGGCACAGGGATGGGG 0: 1
1: 0
2: 5
3: 27
4: 365
1069664151_1069664158 2 Left 1069664151 10:70143841-70143863 CCTTCATGGAAGTGCTCAGCGGG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1069664158 10:70143866-70143888 CAGGGATGGGGACATCATCCAGG 0: 1
1: 0
2: 2
3: 35
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069664151 Original CRISPR CCCGCTGAGCACTTCCATGA AGG (reversed) Exonic
900408154 1:2501429-2501451 CCCCCTGAGCCCTGCCAAGATGG - Intronic
902648951 1:17823957-17823979 CCCTCAGAGAGCTTCCATGAAGG + Intronic
903334868 1:22618184-22618206 CCCGCCGGGCCTTTCCATGACGG - Intergenic
903385429 1:22923146-22923168 CTGACTGAGCACTTCCACGAGGG - Intergenic
905695106 1:39968143-39968165 CACGCTGAGCACCTCCAGGCAGG + Intronic
906681098 1:47725852-47725874 CCCGCTCAGCAGTGCCCTGAAGG - Intergenic
908494554 1:64681171-64681193 CCTGCTGAGCACTTGTTTGATGG - Intronic
915330451 1:155108639-155108661 CCTGCTGAGCTCTAACATGAAGG - Intergenic
918133238 1:181646906-181646928 CCCGCTGAGCACTCCTGTGCAGG + Intronic
922518882 1:226228796-226228818 CCTCCTGAGCACCTCCAGGATGG - Intergenic
1065455999 10:25907343-25907365 GAAGCTGAGCATTTCCATGAGGG - Intergenic
1069664151 10:70143841-70143863 CCCGCTGAGCACTTCCATGAAGG - Exonic
1076072599 10:127502927-127502949 CCAGCTGGGCACTTACCTGAAGG - Intergenic
1082004124 11:47410318-47410340 CCCACTGAGCCCCACCATGAGGG - Exonic
1083779568 11:64910867-64910889 CCCGAAGTGCACTTCCATGCTGG + Exonic
1084604180 11:70162750-70162772 CCCCCTGAGCGCATCCAGGATGG + Intronic
1092050426 12:5465782-5465804 CCTACTGAGCTCTTCCATCAGGG + Intronic
1101626453 12:106447566-106447588 CTCGCTCAGCACTACCAGGAAGG + Intronic
1102477295 12:113196815-113196837 CCCCCTGAGCACTTCCCTCCAGG + Intronic
1106457307 13:29938442-29938464 CTGGCTGAGCATCTCCATGAGGG - Intergenic
1118716101 14:68561140-68561162 CCAGCTGAGAACTCCCATGCTGG + Intronic
1120691744 14:87600516-87600538 CCTGCTGACCACTCCCAAGAGGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124338638 15:28875831-28875853 CCAGCTGGGCCCTTCCATCATGG - Intergenic
1125540540 15:40467428-40467450 CTAGCTGAGCACTTCCACAAGGG + Exonic
1128358505 15:66944492-66944514 CCCGCTGAGCTCTTACAGGCAGG - Intergenic
1137548675 16:49421828-49421850 CCCGCAGAGCACTGTGATGAGGG - Intergenic
1138076546 16:54048357-54048379 CCTGCTGGGGCCTTCCATGAAGG - Intronic
1141558474 16:84851635-84851657 CCCGCTGCGCTCATCCATGTGGG - Intronic
1142550217 17:733420-733442 CACGCTTATCTCTTCCATGAAGG - Intronic
1142861217 17:2763040-2763062 CCCGCTGAACACTACACTGAAGG - Intergenic
1143891422 17:10105403-10105425 ACCGCTGAGCACTTGCAAAATGG - Intronic
1148854227 17:50569911-50569933 CCCACTGAGCCCTTCTCTGACGG - Intronic
1156848460 18:41697736-41697758 CCTGCTGAGGATGTCCATGAGGG - Intergenic
1160538355 18:79607276-79607298 CCCGGTGAGCAGCTCCATCAGGG + Intergenic
1163537196 19:17883691-17883713 GCCGCTGATGACTCCCATGACGG - Exonic
1163688387 19:18725195-18725217 CCCCCTCAGCATTGCCATGAGGG - Intronic
1165471746 19:36008305-36008327 CCTCCTGAGCACTTCCAGGGTGG - Exonic
925334981 2:3090347-3090369 CCCTCTGAGCACTGCCTTCATGG - Intergenic
928391184 2:30912207-30912229 CCTGCTGAGCACTTACCTGTCGG + Exonic
935639145 2:105274323-105274345 TCCCCTGAGCACTTACATGTGGG + Intronic
940361285 2:152798941-152798963 CCCACTGAGCAGTTACAGGAAGG - Intergenic
944655407 2:201872415-201872437 GCCCCCGAGCACTTCCATGTGGG + Intronic
1168939146 20:1694466-1694488 CCAGCTGAGCCCTTCAAGGAAGG + Intergenic
1169499854 20:6148585-6148607 CCTGGTGAGCACTTCCCTGGGGG - Intergenic
1173231881 20:41204810-41204832 CCCGCTGAGACCTTGCCTGAAGG - Exonic
1174228568 20:49025111-49025133 CACACTGAGCCGTTCCATGATGG - Intronic
1181628461 22:24137301-24137323 CCCGCAGAGCACATCCAAGTTGG + Intronic
1185254953 22:49827063-49827085 CCCGCCGAGCTCTGCCAAGACGG - Intronic
950003865 3:9678782-9678804 CCCCCTGGGCACATCCATCATGG + Intronic
962460121 3:135604229-135604251 CCCGGTGGGCAGTTCCAAGATGG + Intergenic
969712879 4:8854203-8854225 GCCCCTGAGCACTTCCCTGGAGG - Intronic
980229397 4:130029612-130029634 CCTGCTGGGCACTTCCCTGAGGG - Intergenic
988307423 5:29510436-29510458 CCAGCTGAGCTCTTCTCTGAAGG - Intergenic
988650791 5:33148390-33148412 AACGCAGAGCACTCCCATGAGGG - Intergenic
1003251683 6:4433984-4434006 CCCTCTGGGCTCTTCCATGGGGG + Intergenic
1011363091 6:86549296-86549318 GCCTCTGCTCACTTCCATGAAGG + Intergenic
1012366541 6:98447510-98447532 CCCAATGAGGAATTCCATGATGG + Intergenic
1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG + Intronic
1020809162 7:12830190-12830212 TCCTCTGAGCAATTGCATGATGG - Intergenic
1022095059 7:27134737-27134759 CACCCTGATTACTTCCATGAAGG + Intronic
1022172091 7:27840510-27840532 GCGGGTGAGCACTTCCTTGAGGG + Intronic
1026191262 7:68130041-68130063 CTGTCTGATCACTTCCATGAGGG - Intergenic
1027714718 7:81655381-81655403 CAGGCTGAGGACTTCCATCAAGG - Intergenic
1031128065 7:117797047-117797069 CCAGCTGAGCAGCTACATGAAGG - Intronic
1034672798 7:152870771-152870793 CTCGCTGAGCACTTCCACGCTGG - Intergenic
1042932006 8:74023143-74023165 CCCGCTGCCCACTTCCCTGCTGG + Intronic
1046976362 8:120282839-120282861 CCTGCTGTTCCCTTCCATGAGGG - Intronic
1049773051 8:144392571-144392593 CTCCCTGAGCACCGCCATGACGG - Exonic
1057842342 9:98496174-98496196 GCCACTGAGCACTTTCCTGATGG - Intronic
1189558089 X:42165941-42165963 CCCTCTGTGCACTTTCATGCAGG + Intergenic
1190627141 X:52346811-52346833 TGCCCTGAGCACTTCCAGGAAGG - Intergenic
1195966312 X:110433032-110433054 CCAGCAGAGCACTGCCAAGAGGG + Intronic
1196141164 X:112265110-112265132 CCTGCAGAGCACTGCCAAGAGGG - Intergenic
1199803570 X:151275023-151275045 CCAGCTCAGCAATTCTATGAGGG - Intergenic