ID: 1069664486

View in Genome Browser
Species Human (GRCh38)
Location 10:70145656-70145678
Sequence GAAGCGCGTCGCGGGCGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069664475_1069664486 28 Left 1069664475 10:70145605-70145627 CCTCTGGCGGCAGAAGGGCGGCC 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1069664486 10:70145656-70145678 GAAGCGCGTCGCGGGCGGCGCGG 0: 1
1: 1
2: 0
3: 12
4: 137
1069664480_1069664486 7 Left 1069664480 10:70145626-70145648 CCAGGGCAGCGGTGCTGTGCGGC 0: 1
1: 0
2: 2
3: 23
4: 213
Right 1069664486 10:70145656-70145678 GAAGCGCGTCGCGGGCGGCGCGG 0: 1
1: 1
2: 0
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069664486 Original CRISPR GAAGCGCGTCGCGGGCGGCG CGG Exonic
902044178 1:13513054-13513076 GGAGCGCAGCGCGGGCAGCGCGG + Exonic
903233837 1:21937252-21937274 GCGGCGCGGAGCGGGCGGCGCGG - Exonic
906640522 1:47438270-47438292 GGAGCACGTCCCGGGGGGCGCGG - Exonic
909025478 1:70477287-70477309 GAATCGCGCAGCGGGAGGCGGGG - Intergenic
910935101 1:92480855-92480877 GAAGCGGGCTGCCGGCGGCGCGG - Exonic
912492711 1:110070728-110070750 GGCGCGCGCCGCGGGGGGCGGGG + Intronic
912993484 1:114511106-114511128 GACGCGGGCGGCGGGCGGCGCGG - Exonic
919831051 1:201540140-201540162 GACGCGAGTGGCGGGTGGCGGGG + Intergenic
1062982424 10:1736790-1736812 GAAGTGGGGCGAGGGCGGCGAGG - Intronic
1064443121 10:15371104-15371126 GCGGCGCGTCACGGGCGGCCGGG + Intergenic
1065024380 10:21526594-21526616 GAGGCGCGGCGGGGGCGTCGAGG - Intergenic
1065099889 10:22321850-22321872 CAGGCGCGGGGCGGGCGGCGCGG - Intronic
1065390081 10:25174582-25174604 GAGGCGGCCCGCGGGCGGCGGGG - Intergenic
1066429371 10:35336965-35336987 GACGCGGGGCGCGGGCGGCGGGG - Exonic
1069664486 10:70145656-70145678 GAAGCGCGTCGCGGGCGGCGCGG + Exonic
1072926466 10:99620879-99620901 GGATCGCGTCGGGGGCGGGGCGG + Intergenic
1077065643 11:639986-640008 GAGGCGGGGCGCGGGTGGCGTGG - Exonic
1080387922 11:31820398-31820420 GAAGGGCACCGCGGGCGGCCCGG + Intronic
1081576252 11:44320093-44320115 GATGCGCGGGGCGGGGGGCGGGG - Intergenic
1082076705 11:47980759-47980781 GAAGCCCGGGGCGGGCGGAGCGG + Exonic
1082807296 11:57459290-57459312 GAGCCGCGGCGCGGGCAGCGGGG + Intergenic
1083572789 11:63769054-63769076 GAAGCGCGTCGCAGCGGACGCGG - Intergenic
1083999583 11:66288915-66288937 GGGGCGCGGCGCGGCCGGCGGGG - Intronic
1084968111 11:72754926-72754948 GATGGGCGGCGCGGGCGGCGAGG - Exonic
1090076639 11:123584085-123584107 GAAGCCCACCGCGGGCGGGGTGG - Intronic
1096779723 12:53984907-53984929 GAAGCGCCCCCCGGGCGGCAGGG - Intergenic
1097191200 12:57220388-57220410 GAGGCGCGGGGCGGGGGGCGGGG + Intronic
1102101324 12:110281151-110281173 CCAGCGCGGCGCGGGCGGCGCGG - Intronic
1103749823 12:123151006-123151028 GAAGCGCCGGGCGGGCGGCCGGG + Intergenic
1105413835 13:20192795-20192817 GAAGCGCGGCGGGGCCGGGGCGG + Intronic
1106406645 13:29480402-29480424 GATGCAGGTGGCGGGCGGCGGGG + Intronic
1106517169 13:30465412-30465434 GGAGCGCGGCCGGGGCGGCGGGG - Intronic
1112503071 13:99957049-99957071 GGCGCGGGGCGCGGGCGGCGGGG - Intergenic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1113813086 13:113154043-113154065 GAGGCGGGGCGCGGGGGGCGGGG + Intergenic
1113869317 13:113548472-113548494 GGAGCGCTTCTCGGGCGGCACGG + Intronic
1113914832 13:113863960-113863982 GAGGCGAGCCGCGGGCGCCGCGG + Exonic
1118971673 14:70642546-70642568 GGACCGCGGCGCGGGGGGCGCGG - Intronic
1119601904 14:75982306-75982328 GACGCGGGCCGCGGACGGCGCGG - Intronic
1122066007 14:99174942-99174964 GAAGCGTGCGGCGGGCGGCGGGG - Exonic
1122162236 14:99793157-99793179 GGAGCGCGGCCCGGGCGGCCTGG - Intronic
1122602483 14:102928576-102928598 AAGGCGCGTCGAGGGGGGCGAGG + Intronic
1124652325 15:31483266-31483288 GCGGCGCGGCGCGGGCGGCGAGG - Exonic
1127165845 15:56244016-56244038 GAAGCGCGCCGCTGGGGGCCGGG + Intronic
1127893800 15:63277508-63277530 TAAGCGGGACGCGGGGGGCGGGG - Intronic
1129273885 15:74433259-74433281 GAAGCGCGGCGGCGGCGGCAAGG + Intronic
1129708153 15:77806390-77806412 GAAGAGGGTCGAGGGCGGAGGGG + Intronic
1132517062 16:370700-370722 GAAGGGCGGCACGGGCGGGGCGG + Intergenic
1132805524 16:1773446-1773468 GAAGCGCCTCGCGGTGTGCGTGG + Exonic
1132968552 16:2673444-2673466 GCGGGGCGTCGCGGGGGGCGGGG - Intergenic
1132978347 16:2721388-2721410 GGGGCGCGGCGCGGGCGGCCAGG + Intergenic
1133001923 16:2856200-2856222 GAACCGGGTTGTGGGCGGCGAGG - Exonic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1137655238 16:50153465-50153487 GGGGCCCGCCGCGGGCGGCGCGG - Intronic
1141054528 16:80803719-80803741 GGGGCGCGCCGCGGCCGGCGGGG - Intronic
1141831013 16:86510089-86510111 GCCGAGCGCCGCGGGCGGCGGGG + Intergenic
1142374874 16:89701672-89701694 GAAGCGCGCGGCGCGCGGGGAGG - Exonic
1147833749 17:43315388-43315410 GAAGGGGGTGGGGGGCGGCGGGG + Intergenic
1148090253 17:45019076-45019098 GGAGGGCGGCGAGGGCGGCGAGG + Intergenic
1148646991 17:49224969-49224991 GAAGCGCGGCGCGCCCTGCGCGG + Exonic
1148664181 17:49362172-49362194 GCAGCGCGGGGCGGGCGGCAGGG + Intronic
1152108037 17:78342079-78342101 GAAGCCCGTCGGGGCCGGCGGGG + Intergenic
1152721879 17:81927468-81927490 GCGGCGCGGCGGGGGCGGCGGGG - Intronic
1152842226 17:82577442-82577464 GCAGGGCGTGGCGGGCGGCCGGG + Intronic
1152924134 17:83079820-83079842 GGGGCGCGGCGCGGGCGGCCTGG + Exonic
1153488868 18:5628916-5628938 GAAGCGCGGCGCGGGAGGTGGGG - Intronic
1160025064 18:75209651-75209673 CGAGCGCGGCCCGGGCGGCGGGG + Intergenic
1160633305 18:80262462-80262484 GACACACGTCGCCGGCGGCGCGG - Intergenic
1160858967 19:1229678-1229700 TAGTCGCGGCGCGGGCGGCGGGG + Exonic
1160859057 19:1230072-1230094 GGAGCGCGGCGCGGGCAGCGCGG - Exonic
1160966641 19:1749631-1749653 CGAGCGCGAGGCGGGCGGCGCGG + Intergenic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1164643860 19:29844517-29844539 GACGCGCGGCGCGGGAGACGCGG - Intergenic
1166347763 19:42177004-42177026 CAAGCGCGGCGCGGGCGGGCGGG + Intronic
1167377311 19:49119108-49119130 GGAGCGAGTAGCGCGCGGCGTGG - Exonic
1168144895 19:54415473-54415495 CGAGCGGGGCGCGGGCGGCGCGG - Intronic
1168272837 19:55259153-55259175 CAAGCGCGTCTGCGGCGGCGGGG - Intergenic
1168286937 19:55339951-55339973 GAAGCGGGTGAGGGGCGGCGCGG + Exonic
1168354965 19:55695190-55695212 GGTGAGCGTCGCGGGAGGCGCGG - Exonic
926268196 2:11344724-11344746 GAAGCGCGGTGCGCGGGGCGGGG - Intronic
930089418 2:47520960-47520982 GAACGGCTTCTCGGGCGGCGTGG - Exonic
932757912 2:74421683-74421705 GGAACGTGCCGCGGGCGGCGCGG - Intronic
933139819 2:78779178-78779200 CAAGCGCGGCGCGGGCGGGCTGG - Intergenic
934993368 2:98936468-98936490 GAGGCGGGTCGGGAGCGGCGCGG - Intergenic
937045104 2:118846976-118846998 GCAAGGCGCCGCGGGCGGCGAGG + Exonic
940775151 2:157876559-157876581 CAGGCGCGCCGGGGGCGGCGCGG - Intergenic
942505613 2:176638268-176638290 GCGGCGGGTGGCGGGCGGCGCGG + Intergenic
946747486 2:222860889-222860911 GGAGCGCGGCGCTGGCGGCCCGG - Intergenic
947745053 2:232503169-232503191 GGAGCGCGGCGGGGGCGGTGAGG - Intergenic
1170756804 20:19212486-19212508 GCGGCGCGGCGGGGGCGGCGGGG - Intergenic
1172890518 20:38260735-38260757 TAAGGGAGCCGCGGGCGGCGCGG + Exonic
1176548903 21:8213251-8213273 GGAGCGCGTCCCGGTCGCCGCGG + Intergenic
1176556798 21:8257464-8257486 GGAGCGCGTCCCGGTCGCCGCGG + Intergenic
1176567834 21:8396286-8396308 GGAGCGCGTCCCGGTCGCCGCGG + Intergenic
1176575737 21:8440505-8440527 GGAGCGCGTCCCGGTCGCCGCGG + Intergenic
1178680599 21:34669837-34669859 GTAGCGCGTCCGGGGAGGCGGGG + Exonic
1178840709 21:36135612-36135634 AAACCGCCTCGCGGGAGGCGTGG - Intronic
1178914544 21:36699253-36699275 GGAGCGAGTCGCAGGCGGCTGGG - Exonic
1179675018 21:42975063-42975085 GGAGCCCGGCGCGGGCGGGGCGG + Intronic
1180101531 21:45590046-45590068 GAAGCGCGGCCGGGCCGGCGCGG - Intergenic
1180960668 22:19760998-19761020 GTAGCGCGGCGGCGGCGGCGGGG - Exonic
1181079709 22:20405744-20405766 GCAGCGCGGGGCGGGCGCCGGGG + Exonic
1203253788 22_KI270733v1_random:129559-129581 GGAGCGCGTCCCGGTCGCCGCGG + Intergenic
1203261844 22_KI270733v1_random:174638-174660 GGAGCGCGTCCCGGTCGCCGCGG + Intergenic
950590486 3:13933102-13933124 GAAGCTCGTCCCGGGCGCCCCGG - Intergenic
950902998 3:16513710-16513732 GACGCGCGGCGGCGGCGGCGGGG - Intronic
952867229 3:37862121-37862143 GGGGCGCGGCGCGGGGGGCGCGG - Intronic
955277015 3:57556391-57556413 GAAGCGCGGCGCGGGCGCCTGGG - Exonic
961013348 3:123449642-123449664 GGAGCGCCTCTCGGGCGCCGCGG - Exonic
961202516 3:125055945-125055967 GCAGCGGGCAGCGGGCGGCGGGG + Exonic
966381240 3:179347342-179347364 GAAGAGGGTCGGGGGCGGGGGGG + Intergenic
968186962 3:196639637-196639659 GAAGCGCGGCGCGGGCGCGGGGG - Intergenic
968573572 4:1354778-1354800 TGAGTGTGTCGCGGGCGGCGTGG - Exonic
972765862 4:42151958-42151980 GAAGGGCGGCGGGGGCGGCGGGG + Exonic
975870773 4:78776360-78776382 GAGCCGCGGAGCGGGCGGCGGGG + Exonic
985660708 5:1155513-1155535 GGAGCGCGCGGCGGGCGGCAGGG + Intergenic
989103514 5:37840368-37840390 AAAGCCCGGCGCGGGCGCCGCGG - Intergenic
997302005 5:132813416-132813438 GAAGGGCGCCGGGGGCCGCGGGG - Intergenic
1002638328 5:180618983-180619005 GCGGGGCGCCGCGGGCGGCGGGG - Intronic
1006271123 6:32968476-32968498 GAACCGCATCTCCGGCGGCGGGG - Intronic
1006351087 6:33521683-33521705 TGAGCGCGGCGCGGGCGGCCCGG + Intergenic
1006427619 6:33976146-33976168 GAAGCGGGGCGCAGGCGGGGCGG - Intergenic
1006785072 6:36660910-36660932 CTAGCGCGCCGCGGGAGGCGGGG - Intergenic
1010980587 6:82364985-82365007 GACGCCCGTCCCCGGCGGCGGGG - Exonic
1012548798 6:100449295-100449317 GAAGCAAGGCGCGTGCGGCGTGG - Intronic
1015965575 6:138693030-138693052 GCAGGGCTTCGCGGGCCGCGCGG + Intergenic
1019437118 7:1028083-1028105 GAAGCGCGGCTCGGCCGGCCCGG + Intronic
1023838510 7:44082358-44082380 GAAGCGCGTCGAGGGCGGCGTGG + Exonic
1029640449 7:101816500-101816522 GGAGCGGGGAGCGGGCGGCGGGG + Intronic
1031213347 7:118858873-118858895 AAAGCGCGGCGCGGGCGGGCTGG + Intergenic
1033361338 7:140640721-140640743 GAAGCGCGCCGCTGGGGCCGGGG - Exonic
1034222783 7:149459505-149459527 GCGGCCCGTCGGGGGCGGCGGGG - Intronic
1034414723 7:150958410-150958432 GTCGGGCGGCGCGGGCGGCGCGG - Exonic
1035717178 8:1763604-1763626 GGGGCGCGGCGCGGGGGGCGGGG - Intronic
1037811490 8:22089448-22089470 GAAGCGGGGCGCGGCCGGGGAGG - Intronic
1037825295 8:22156802-22156824 GGACTGCGGCGCGGGCGGCGGGG + Exonic
1044963925 8:97557099-97557121 CAAGCGCGGCGCGGGCGGGCGGG - Intergenic
1049417129 8:142500326-142500348 GAGGAGCGGCGCGGGGGGCGGGG - Intronic
1049585671 8:143431341-143431363 GAAGCACGGGGCGGGCGGAGGGG + Intergenic
1051483023 9:17579398-17579420 GAGGCGGGGCGCGGCCGGCGCGG - Intronic
1051774517 9:20620550-20620572 CGAGCGCGGCGCGGGGGGCGGGG + Intronic
1053434851 9:38068060-38068082 GGAGAGCGCCGCGGGCGGTGGGG - Exonic
1055030562 9:71768705-71768727 GAATCGTGGCCCGGGCGGCGCGG + Exonic
1061380588 9:130254422-130254444 GAAGCGGGGCGGGGGCGGGGTGG - Intergenic
1061520063 9:131112505-131112527 GAAGCACTTCTCGTGCGGCGTGG + Intronic
1062346816 9:136118790-136118812 GAAGTGCGGCTCGGTCGGCGCGG - Exonic
1062491867 9:136808593-136808615 GGAGCGGGTCGGCGGCGGCGGGG + Intronic
1203771843 EBV:53611-53633 CAAGCGGGTCGCGGGGGGCAAGG - Intergenic
1203470188 Un_GL000220v1:112707-112729 GGAGCGCGTCCCGGTCGCCGCGG + Intergenic
1203478009 Un_GL000220v1:156679-156701 GGAGCGCGTCCCGGTCGCCGCGG + Intergenic
1200146340 X:153928179-153928201 GGAGGGCGCCGCGGGCGCCGTGG + Intronic