ID: 1069665774

View in Genome Browser
Species Human (GRCh38)
Location 10:70156690-70156712
Sequence CAAGGTAAAGACTGCGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069665769_1069665774 26 Left 1069665769 10:70156641-70156663 CCAGCCTGGGCCACAGAGGAAGA 0: 21
1: 1874
2: 50044
3: 182454
4: 232789
Right 1069665774 10:70156690-70156712 CAAGGTAAAGACTGCGTGGCAGG No data
1069665770_1069665774 22 Left 1069665770 10:70156645-70156667 CCTGGGCCACAGAGGAAGATTCT 0: 1
1: 49
2: 1680
3: 23122
4: 100303
Right 1069665774 10:70156690-70156712 CAAGGTAAAGACTGCGTGGCAGG No data
1069665771_1069665774 16 Left 1069665771 10:70156651-70156673 CCACAGAGGAAGATTCTGTTTAA 0: 1
1: 0
2: 10
3: 110
4: 899
Right 1069665774 10:70156690-70156712 CAAGGTAAAGACTGCGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069665774 Original CRISPR CAAGGTAAAGACTGCGTGGC AGG Intronic
No off target data available for this crispr