ID: 1069667642

View in Genome Browser
Species Human (GRCh38)
Location 10:70174163-70174185
Sequence CAGAAGGAGTGGTAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 365}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069667633_1069667642 21 Left 1069667633 10:70174119-70174141 CCAGGAACATCTGGGAGGCCAGT 0: 1
1: 0
2: 2
3: 25
4: 238
Right 1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG 0: 1
1: 0
2: 2
3: 33
4: 365
1069667636_1069667642 3 Left 1069667636 10:70174137-70174159 CCAGTGTGACCAGGCAAGGTGAG 0: 1
1: 0
2: 3
3: 12
4: 183
Right 1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG 0: 1
1: 0
2: 2
3: 33
4: 365
1069667637_1069667642 -6 Left 1069667637 10:70174146-70174168 CCAGGCAAGGTGAGCAACAGAAG 0: 1
1: 0
2: 0
3: 20
4: 181
Right 1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG 0: 1
1: 0
2: 2
3: 33
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069667642 Original CRISPR CAGAAGGAGTGGTAGGAAAT GGG Intergenic
901145553 1:7062427-7062449 CAGAATGAGTGACAGGGAATGGG + Intronic
901560832 1:10068946-10068968 CAGAAGGAGTAGGAGAAGATTGG - Intronic
901863472 1:12089205-12089227 TGGAAGGAGTGTTAGGAAAGTGG - Intronic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
904663381 1:32101729-32101751 CAGGAGAAGTGGTAGGAAATGGG - Intronic
905197873 1:36295259-36295281 CAGCAGGAGTGGCAGAAACTAGG - Intronic
905321628 1:37121370-37121392 CAGAAGGAGAGGTTGGGAAGGGG - Intergenic
905651079 1:39657414-39657436 GAGATGTGGTGGTAGGAAATAGG - Intergenic
905904205 1:41606158-41606180 GAGATGGGGTGGAAGGAAATTGG - Intronic
906450882 1:45946430-45946452 CATAAAGAGAGGGAGGAAATTGG - Intronic
906465149 1:46071897-46071919 AAGAAGAAGTGGTAGGGGATAGG - Intronic
906723167 1:48023887-48023909 AAAAGAGAGTGGTAGGAAATTGG + Intergenic
907281598 1:53350612-53350634 CAGATGGAGGGGTAGGAAAATGG - Intergenic
907620375 1:55971846-55971868 TAGGAAGAGTGGTAAGAAATGGG + Intergenic
908119963 1:60976769-60976791 AAGAAGGAAAGGGAGGAAATAGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
910995458 1:93100003-93100025 GAGGATGAGAGGTAGGAAATAGG + Intronic
913462812 1:119106040-119106062 AAGAAAGATAGGTAGGAAATAGG + Intronic
913546716 1:119876164-119876186 AAGAAGCAATGGTAGGAACTGGG + Intergenic
914851947 1:151321319-151321341 AAGAAGGTGTTGTAGGGAATAGG + Intronic
914978436 1:152389462-152389484 CAGCAGGAGTGGGAGCAAAAAGG - Intergenic
915332347 1:155120938-155120960 AAGAAGGAGTGGGAGCAAAGCGG - Intergenic
915491130 1:156250591-156250613 TACAAGCAGTGGAAGGAAATTGG - Exonic
915921332 1:159977962-159977984 CAGAAAGAGTGGTTAGAAGTGGG + Intergenic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916547718 1:165822278-165822300 AAGAAAGAGTTTTAGGAAATGGG - Intronic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917150072 1:171933623-171933645 GAGACGGGGTGGTAGGAAATGGG + Intronic
918201557 1:182272102-182272124 GAGGCTGAGTGGTAGGAAATGGG + Intergenic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
919227493 1:194725670-194725692 CAGAAGGAGGGGGAGGATAAAGG - Intergenic
919943407 1:202303818-202303840 CAGAATGAGTGTCAGGAAGTCGG + Intronic
921530013 1:216270577-216270599 AAGAAGAAGTGGTAGAAACTGGG - Intronic
922690763 1:227687988-227688010 CAAAAGGAGTGGAATCAAATTGG + Intergenic
923006956 1:230057869-230057891 AGGCAGGAGGGGTAGGAAATGGG + Intergenic
923533408 1:234829550-234829572 CAGAAGAATTGATAGGAAAAAGG + Intergenic
1064126566 10:12666556-12666578 GGGAAGGACTGTTAGGAAATGGG + Intronic
1064489048 10:15830716-15830738 GAGAATGAGGGGTAGGAAAAAGG + Intronic
1065546278 10:26824729-26824751 CAGGAGGAGAGGTAATAAATAGG + Intronic
1066468074 10:35670734-35670756 CAGAAGAAATGGTAGTAATTGGG + Intergenic
1067123581 10:43496055-43496077 CAGGAGGAGTGGTAGCATCTGGG + Intergenic
1067511624 10:46899589-46899611 GAGAAAGACTGGTAGGAAACAGG + Intergenic
1067650622 10:48152236-48152258 GAGAAAGACTGGTAGGAAACAGG - Intergenic
1067838498 10:49656746-49656768 AAGAAGGACTGGTTGGAATTGGG + Intronic
1068089334 10:52413289-52413311 GAGAATGAGTGGTATGAAAATGG + Intergenic
1068726629 10:60310397-60310419 CAAAAGCAGTGCTTGGAAATAGG - Intronic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1070324479 10:75378942-75378964 CAGACAGGGTGGTAGGAAACAGG - Intergenic
1070719340 10:78745464-78745486 CAGAAGCCCTGGTAGGAATTAGG + Intergenic
1074003049 10:109391464-109391486 CAGAAGCAGTAGCAGGAAAGAGG + Intergenic
1074769921 10:116726575-116726597 CAGAAGGAACTGTGGGAAATTGG - Intronic
1077482304 11:2821488-2821510 CAGATGGAGTGGGAGGCCATTGG + Intronic
1079240187 11:18717011-18717033 CAGTAGGAGTGGTAGTCATTGGG + Intronic
1079675732 11:23224140-23224162 CAGGAGGAGTGGGTGTAAATAGG - Intergenic
1080123530 11:28704625-28704647 GAGGAAGGGTGGTAGGAAATGGG + Intergenic
1080885471 11:36363696-36363718 CAGAAAGACTGGTAGGTAAAGGG - Intronic
1081879919 11:46440456-46440478 GAGGAGGAGTGGTAGGATTTGGG + Intronic
1081988405 11:47324367-47324389 CAGAAGGACTGGTAGAAACAGGG - Intronic
1084893944 11:72251600-72251622 CAGAAGGAGTGGCAGGTAAAAGG + Intergenic
1085934829 11:81128395-81128417 CAGATGAGGTGGTAGGAAAGAGG + Intergenic
1086419317 11:86622836-86622858 CAGGGGGAGTGGTTGGGAATAGG - Intronic
1086589357 11:88493939-88493961 TAGAATGAGAGCTAGGAAATGGG + Intergenic
1087899684 11:103626689-103626711 CAGAAGGATTGGTTCCAAATGGG - Intergenic
1090118169 11:123996852-123996874 CAGAGGATGTGGAAGGAAATAGG + Intergenic
1090313600 11:125765185-125765207 CACAATGAGTGGAAGGAACTAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093771527 12:23023355-23023377 CAGAAGTAGTGTAAGAAAATGGG + Intergenic
1094361606 12:29637394-29637416 CAGAATTTGTGGTAGAAAATTGG - Intronic
1094441757 12:30485616-30485638 CAGAGGGAGCAGCAGGAAATGGG - Intergenic
1095992659 12:48047322-48047344 CAGAAGGAATGGTAGGTAGAAGG - Intronic
1096202765 12:49697299-49697321 CTAAAGGTGTGCTAGGAAATGGG + Intronic
1096263704 12:50107989-50108011 CAGGATGAGTGGATGGAAATGGG - Intronic
1097406757 12:59198628-59198650 CAGAAGGTGAGGAAGGAAAGTGG - Intergenic
1098669082 12:73201901-73201923 GAGAAGGATTGGCAAGAAATAGG - Intergenic
1099342190 12:81451252-81451274 CAGGGGGAGGGGTAGAAAATGGG - Intronic
1099674285 12:85737636-85737658 AAAGAGAAGTGGTAGGAAATGGG - Intergenic
1099807435 12:87537167-87537189 AGGAAGGAGTGGTAGAAAAGAGG - Intergenic
1100452713 12:94722783-94722805 GAGAAGGGCTGGTAGGAACTAGG - Intergenic
1101523047 12:105502669-105502691 CCGTGGGAGTGGCAGGAAATGGG + Intergenic
1101761004 12:107659129-107659151 CTGAAGGCATGCTAGGAAATAGG - Exonic
1102150273 12:110684862-110684884 CAGAAGGCGACGTAGGAAACTGG - Intronic
1103104266 12:118209322-118209344 TAGAAGGAGAGGTACAAAATAGG + Intronic
1104634846 12:130431763-130431785 CAGAAGGAGTGGGAGGCCCTCGG + Intronic
1105074323 12:133262248-133262270 GAGAAGTAGTGGTAGGGAAATGG - Intergenic
1105664844 13:22542440-22542462 CTGCAGGAGTGGTAGTGAATAGG + Intergenic
1105806234 13:23953206-23953228 CAGATGGAGTTGTTGGGAATGGG - Intergenic
1107038073 13:35921223-35921245 GAGAAAAAGTGGTAGGAAACAGG - Intronic
1109049555 13:57460590-57460612 AAGATGGAGTGGGAGGAAAAGGG + Intergenic
1110469410 13:75842059-75842081 GAGAATGGGTGGTAGGAAACAGG - Intronic
1110797430 13:79656547-79656569 CAGAAGTAGAGGAAGGATATTGG - Intergenic
1110873989 13:80487233-80487255 CAGGAGGACTGGTAACAAATTGG + Intergenic
1111046785 13:82824054-82824076 CAGAAGAAGTGGTGGGAATAGGG + Intergenic
1111425228 13:88071564-88071586 AAGAAGGAGGGGCAGGAAACAGG - Intergenic
1114275073 14:21135668-21135690 GAGAAGGAGTGGGAGAAGATGGG - Intergenic
1114934808 14:27520859-27520881 CAAAAGGAGAGGAAGGAAAGAGG + Intergenic
1114945120 14:27671758-27671780 CAGTAGGAATAGGAGGAAATAGG - Intergenic
1117798583 14:59419918-59419940 CAGAAGAAGTGGGAAGAAAAAGG - Intergenic
1118175973 14:63440368-63440390 CAGCAGAAGTGGTAGGAGAGAGG + Intronic
1118335489 14:64850283-64850305 CCAAAGGAGTGGTAGGATAAGGG + Intronic
1121042750 14:90762290-90762312 CAGAGGCACTGGTAGGAAATTGG - Intronic
1124213237 15:27781293-27781315 GAGAAAGAGTGGTAGGAACTGGG - Intronic
1124952877 15:34339439-34339461 CAGATACACTGGTAGGAAATTGG - Intergenic
1124957847 15:34371172-34371194 GAGTAGGAGAGGTAGGAAGTGGG - Intergenic
1125622245 15:41073960-41073982 CACAAGGAGAGGGAGGAATTGGG - Intronic
1126450783 15:48806340-48806362 CAGAAGCAGCAGCAGGAAATGGG + Intronic
1127522082 15:59753191-59753213 CAGAAGGCGAGGAAGGAAAACGG - Intergenic
1128421903 15:67499955-67499977 CTGAGGGAGTGGGATGAAATGGG + Intronic
1128881722 15:71249886-71249908 CAGCAGGAGTGGAAGGAAAGGGG - Intronic
1129787695 15:78320429-78320451 CAGATGGAGTGGAAGGAATGGGG - Intergenic
1130004938 15:80086505-80086527 CATAATGGGTGGTAGGAAAGGGG - Intronic
1131413624 15:92232355-92232377 CAGAAGGAGGGGGAGAAAAAGGG + Intergenic
1132538683 16:497006-497028 CTGAAGGAGTGTTGGGAAAGGGG + Intronic
1132941547 16:2510951-2510973 AAGAAGGAGGGGAAGGAAAGTGG + Intronic
1133392714 16:5422638-5422660 GAGAAGGATTGGGAGGAAAGAGG + Intergenic
1134186710 16:12090379-12090401 CAGAGGCAGTGGGAGGGAATGGG + Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1135878810 16:26232091-26232113 CAGAAAAAGTGGTAGTAATTGGG - Intergenic
1136397965 16:30003336-30003358 GAGCAGGAGTGGTAAGAAATTGG + Intronic
1137536355 16:49329766-49329788 AAGGAGGAGTGGTATGAAATGGG - Intergenic
1138580828 16:57939573-57939595 CAGAAGCTGTGGGAGGAAGTTGG - Exonic
1138601440 16:58057238-58057260 AAGAGGCTGTGGTAGGAAATTGG - Intergenic
1138902305 16:61287587-61287609 CAGAAGTAGAGGTGGGAAAAGGG - Intergenic
1139065615 16:63310006-63310028 CCGAAGGGGTGGTGGGAAAGGGG - Intergenic
1139371167 16:66470273-66470295 GAGAAGGACTCGTAGGAAAATGG + Intronic
1139459770 16:67112246-67112268 CAAAAGCAGTGGTAGGGACTGGG + Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140131091 16:72162385-72162407 CAAAAGGAGTGGCAGGGAAGGGG - Intronic
1140701210 16:77583211-77583233 CAGGAGGAGGGGAAGGACATAGG - Intergenic
1141894942 16:86953369-86953391 GAGGAGGAGTGGTAGGGAATGGG + Intergenic
1144437022 17:15251340-15251362 CACAAGGAGTTGGAGGAAACAGG - Intronic
1145029244 17:19492060-19492082 CAGAAATAGTGGCAGGAAATAGG + Intergenic
1145298707 17:21614254-21614276 CAGAAGGAGAGGTTGGACTTTGG + Intergenic
1145351572 17:22089036-22089058 CAGAAGGAGAGGTTGGACTTTGG - Intergenic
1145445271 17:23164736-23164758 CAGAAAGAGTGTTTGGAAACTGG - Intergenic
1145553192 17:24733794-24733816 CAGAAAGAGTGATTGGAAACTGG - Intergenic
1146536967 17:33661090-33661112 CAGAGGGAGTGGAAGGGAGTCGG - Intronic
1149389520 17:56174858-56174880 GAGAGGGAGTGGCAGGGAATGGG + Intronic
1150826064 17:68476541-68476563 CAGAAGGACTGGTAAGAAGCTGG - Intergenic
1152069826 17:78128902-78128924 CAGGAGGAGGGGTCGGAAGTTGG - Intronic
1153482825 18:5564751-5564773 CAGTAGGAGTGGGAGGAGTTGGG - Intronic
1154959937 18:21297989-21298011 GAGGAGGAGTTTTAGGAAATGGG + Intronic
1155520761 18:26666698-26666720 AATAAGGAGTGTTAGAAAATAGG - Intergenic
1156260934 18:35444540-35444562 CAGAAGGAGAGGTGGGCCATCGG + Intronic
1156341607 18:36214721-36214743 CAGAAGGAGAGGGAGGAGATAGG + Intronic
1156630753 18:38965353-38965375 CAGAAGGAGGGTGAGGAAATAGG + Intergenic
1157328409 18:46685821-46685843 CAGAAGCAGTGGTTGGAACCAGG - Intronic
1157424740 18:47575243-47575265 GGGAAGGAGTGGCAGGTAATGGG + Intergenic
1159249339 18:65853554-65853576 CAGAGGGGCTGGTAGAAAATAGG + Intronic
1159370246 18:67519065-67519087 CAGAAAGGGTGGTAGGTAAATGG + Intergenic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1159903045 18:74066015-74066037 TAGAAGGAGTGGCTGAAAATTGG + Intergenic
1160186843 18:76682445-76682467 GAGAAGGAGAAGTAGGGAATGGG - Intergenic
1161777804 19:6273259-6273281 CAGAAGGAGTGGCTGGAAAAAGG + Intronic
1162223918 19:9203909-9203931 CAAAAGGACTTGTAGCAAATTGG + Intergenic
1162393805 19:10404827-10404849 AAGAGGGAGGGGTAGGAGATGGG - Intronic
1162543654 19:11314773-11314795 CAGAAGGAGGGGAAGAAAAGAGG + Intronic
1163501012 19:17676243-17676265 GAGGAGGAGAGGTAGGAAAGAGG + Intronic
1165165111 19:33848305-33848327 CAAAAGAAGTAGAAGGAAATAGG + Intergenic
1167452215 19:49577945-49577967 GGGAAGGATTGGGAGGAAATAGG + Intronic
1167749390 19:51370774-51370796 CAGAAGGTGAGGGAGGAACTTGG - Intergenic
1167770730 19:51514863-51514885 CAGGAGGAGTTGTAGGAATCTGG - Intergenic
925301306 2:2814774-2814796 CAGAAGGGGTGGGATGACATAGG + Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925937800 2:8783424-8783446 GAAAAGGAGTGGTAAGAAAAGGG - Intronic
926008774 2:9392554-9392576 CAGACGGAGAGGCAGGAAAGTGG - Intronic
926604740 2:14886199-14886221 CAGAAAGAGAGGCAGGAATTAGG - Intergenic
926645383 2:15285363-15285385 CAGCAGGAGAGGTAGGTAAGAGG - Intronic
928142345 2:28740671-28740693 CAGAGGAAGTGGTAGGAAATAGG - Intergenic
928143281 2:28749558-28749580 GAGAAGAAGAGGTAGGAGATAGG - Intergenic
928428942 2:31202085-31202107 CAGAGGGAGTCATAGGAAAAAGG - Intronic
929185723 2:39091828-39091850 AAGAAGGAGTGGCAAGAAAGTGG - Intronic
929461402 2:42104250-42104272 GAGAAGAAGGGGTGGGAAATAGG + Intergenic
929676832 2:43942272-43942294 CAGAAGGATTTGAAAGAAATGGG - Intronic
929935674 2:46292883-46292905 CAACAGGAGTGGTAAGAATTTGG - Intergenic
930430300 2:51266831-51266853 CAGAAGGACTTGTAGAAAACAGG + Intergenic
930601882 2:53453183-53453205 CACAAGGAGAGGCAGGAAAGGGG + Intergenic
931199297 2:60081650-60081672 CTGAAGCATTGATAGGAAATAGG - Intergenic
931581276 2:63778056-63778078 CAGGTGGAGTTGAAGGAAATAGG - Intronic
932693094 2:73930148-73930170 CAGAGGGTGTGGTGGGAACTTGG + Intronic
932814330 2:74849690-74849712 AAGAAGGGGTGGAAGGAAAGGGG + Intronic
933440171 2:82302396-82302418 CAAAAGGAGTTTTAGCAAATAGG - Intergenic
933645090 2:84805979-84806001 CAGAAGCATTAGGAGGAAATTGG + Intronic
934943447 2:98519210-98519232 CAGCAGGAGTTGTAGCATATAGG + Intronic
935244114 2:101203466-101203488 CAGGAGGAGTCGGAGGAAAGCGG - Intronic
935266978 2:101403117-101403139 CAGAAGGGGTGGGAGGAAACGGG + Intronic
935878831 2:107540670-107540692 AAGAAAGAGTGCTAGGCAATGGG - Intergenic
936591906 2:113812373-113812395 AAGAAGGAGAGGGAGGAAAGGGG + Intergenic
937221151 2:120344017-120344039 CAGAAGAAGAGGTAGGCGATAGG + Intergenic
937814024 2:126231524-126231546 CAGAAGGAGGGGGAGGAGAATGG - Intergenic
939820810 2:146954883-146954905 GAGAAAGACTGGTAGAAAATGGG + Intergenic
940338120 2:152549812-152549834 CAGAAGGAGGGCTACAAAATAGG - Intronic
941336162 2:164246188-164246210 GAGAAGGAGAGGATGGAAATGGG + Intergenic
941375727 2:164727148-164727170 CAGAAGGAGGGGTATAAAAGAGG + Intronic
941483918 2:166054822-166054844 CTGATGGAGTGATAAGAAATTGG - Intronic
941750172 2:169126997-169127019 AAGAAGGAGTGGTACAGAATTGG + Intergenic
941809244 2:169739009-169739031 CAGAAGGAGGGAGAGGAGATGGG - Intronic
942761513 2:179404108-179404130 CAGAGGAAGGGGTAGGATATGGG - Intergenic
943405164 2:187473713-187473735 CAGGAGAAGTGGTATTAAATTGG + Intronic
943491905 2:188564280-188564302 CACAAGGATTGGAAAGAAATAGG + Intronic
944338914 2:198571607-198571629 CAGAGGGAGTTAAAGGAAATTGG + Intronic
945002587 2:205367362-205367384 GAAAGGGAGTGGAAGGAAATAGG + Intronic
945600947 2:211864189-211864211 AAGAAGGAGAGGTGGGAAAAAGG - Intronic
945877349 2:215292348-215292370 CAGAAGCAGTGGTTGAATATAGG + Intergenic
945967562 2:216205128-216205150 GAGAAGCAGTGGTATGAAATTGG + Intronic
946449265 2:219765760-219765782 CAGAAGGAGTGGAAGGGAGGTGG - Intergenic
946533663 2:220603543-220603565 CAGAATGAGTAATAGGAAAAAGG - Intergenic
1168805784 20:671636-671658 CAGAGGGAGTGAGAGGAAGTGGG + Intronic
1168964033 20:1888113-1888135 GAGAAGGAGTGGAAGGCCATTGG + Intergenic
1169614818 20:7429059-7429081 GAGAAGGGATGGTAGGAAAGTGG - Intergenic
1170409607 20:16074498-16074520 GAGAAGGATTGCTAGTAAATTGG + Intergenic
1172590781 20:36116457-36116479 CAGGAGGAAAGGAAGGAAATGGG - Intronic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1173234091 20:41228000-41228022 CAGAAGGAGAGGAAGGAATGGGG - Intronic
1174688887 20:52482891-52482913 GAGGAGAAGTGGTAGGAAAGTGG + Intergenic
1176172983 20:63704533-63704555 CAGCAGAAGTGGTAGTGAATTGG + Intronic
1176589034 21:8622444-8622466 GAGAAGGAGTTTTGGGAAATAGG - Intergenic
1176649435 21:9531313-9531335 CAGAAGGAGAGGTTGGACTTTGG + Intergenic
1177089470 21:16749081-16749103 CAGAAGGTGAGGTAGGAGAATGG - Intergenic
1178144384 21:29721620-29721642 AAGAAGAAGAGGTAGGAAATAGG + Intronic
1180271858 22:10599441-10599463 GAGAAGGAGTTTTGGGAAATAGG - Intergenic
1181979218 22:26754060-26754082 CAGAGGAAGTGGGATGAAATCGG - Intergenic
1182110525 22:27719861-27719883 CACAGGGAGGGGTGGGAAATGGG + Intergenic
1183421718 22:37715662-37715684 CAGAAGGAAGGGAAGGGAATTGG - Intronic
1184101248 22:42342781-42342803 CTGAAGGAGGGGGAGGAAATGGG - Intronic
1184311670 22:43649135-43649157 CAGAAGGTGAGGGAGGAACTGGG + Intronic
949272590 3:2236910-2236932 CAGAAGAAAGGGTATGAAATGGG + Intronic
949903280 3:8837646-8837668 CAGAGGGAGTGAGAGGAAAATGG + Intronic
952498872 3:33940550-33940572 CAGAAGGAGTGTTAGGGTAGAGG + Intergenic
952728760 3:36617624-36617646 GTGAAGGAGAGGGAGGAAATTGG + Intergenic
953774443 3:45803542-45803564 CAGCAGGAGAGGTAGGGACTGGG - Intergenic
956015915 3:64882390-64882412 CAGAAGGAGTGGGAGGAAGGAGG - Intergenic
956799228 3:72741598-72741620 AAGAAGGAGTGAGAGGAGATAGG + Intergenic
957343997 3:78939050-78939072 CAGAAAGATTGTTAGTAAATAGG - Intronic
957364470 3:79204672-79204694 TGGAAGGAGTCATAGGAAATGGG - Intronic
957865280 3:86014913-86014935 GAGAATGAGTGGTATGAAAATGG + Intronic
958749926 3:98183528-98183550 CAGGAAGAGGGTTAGGAAATGGG - Intronic
959370387 3:105517314-105517336 CAGAATGAGTGGCAGTAAGTTGG - Intronic
960039690 3:113138152-113138174 CAGAAGCAGAGGGAGGGAATGGG - Intergenic
960287015 3:115841219-115841241 GAGATGGAATGGTAGGAAAGAGG - Intronic
960871759 3:122257050-122257072 AAGAAGAAGTGGAAGAAAATGGG - Intronic
961597523 3:128030363-128030385 CAGTAGGACTGGTAGGTCATAGG + Intergenic
962881155 3:139578006-139578028 CACTAGGATTGGCAGGAAATGGG - Intronic
963311302 3:143713178-143713200 CAAAAGGAGTGGTAGGATGGAGG + Intronic
963542876 3:146616945-146616967 CAGAAGTAGAGGAAGAAAATAGG - Intergenic
963787422 3:149548931-149548953 CCGAAGTACTGTTAGGAAATAGG - Intronic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
964433472 3:156628962-156628984 CAGAAGGAGAAGTGGGTAATAGG - Intergenic
966288040 3:178320832-178320854 CACAAAGAATAGTAGGAAATAGG + Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966677238 3:182602686-182602708 CAGTTGGAGTGGTTGGAGATGGG - Intergenic
969166261 4:5318353-5318375 GAGAAGGAGTGATAGGAAGATGG + Intronic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970158817 4:13168746-13168768 CAGGATGAGTGGAAGAAAATGGG - Intergenic
970795647 4:19909466-19909488 TGGAAGGAGTGCTAGGCAATGGG - Intergenic
973641246 4:52905003-52905025 CAGAATGAATGGTAAGAACTTGG + Intronic
975172898 4:71253059-71253081 AAGGAGGAGTTGGAGGAAATGGG + Intronic
975333849 4:73152479-73152501 CAGAAGGAGAGGAAGGGAAGGGG + Intronic
977057291 4:92209392-92209414 AAGAATGAGTGGTTGGATATGGG + Intergenic
977956322 4:103031119-103031141 CAGAAGGAGTAGCGGGAGATGGG + Intronic
977965729 4:103145486-103145508 AAGAAACAGTGGGAGGAAATGGG - Intronic
978788090 4:112632236-112632258 GAGAAGGAGAGGGAGGGAATAGG + Intronic
979378875 4:119984560-119984582 CAGAGGGAGTGGGAGAACATGGG + Intergenic
980817018 4:137961281-137961303 CAGTAGGGGTGATAGTAAATTGG + Intergenic
981840440 4:149105381-149105403 CAGAAGGTGAGGTATTAAATGGG + Intergenic
982162203 4:152581516-152581538 GAGAAGGAGTGGAAGGAAAGTGG - Intergenic
983951066 4:173642018-173642040 CATAAGAAGTGATATGAAATGGG - Intergenic
984391543 4:179140200-179140222 CAGAAACAGAGGTAGGAAGTTGG - Intergenic
984931498 4:184851581-184851603 CAGAAGAACTTGTAGAAAATAGG + Intergenic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
986445284 5:7815964-7815986 CACAAGGAGAGGAAGGAAAGAGG - Intronic
987998340 5:25315177-25315199 TAGATGGAGTGGTAAGGAATTGG - Intergenic
988284545 5:29194483-29194505 GAGAAGGGGTGGGAGGAAAAGGG - Intergenic
988509772 5:31855158-31855180 CAGAACTGGAGGTAGGAAATCGG + Intronic
988590349 5:32543451-32543473 CACCAGGAGAAGTAGGAAATGGG + Intronic
990638750 5:57759042-57759064 CAAAAGCAGTGGTAGGCTATTGG + Intergenic
990647737 5:57863517-57863539 AACAGGGAGTGGTAGGAAGTAGG + Intergenic
990687329 5:58320253-58320275 CAGAAAGAGTGAAAGAAAATGGG + Intergenic
991192378 5:63889381-63889403 CAGAAGAAGTCTTAAGAAATTGG - Intergenic
991475211 5:67011341-67011363 AGCAAGGAGTGGGAGGAAATGGG - Intronic
994163898 5:96587585-96587607 CAGAAAGACCAGTAGGAAATGGG + Intronic
994516619 5:100780357-100780379 AAGGAGGAGTTGTAGGAAGTTGG - Intergenic
994783436 5:104122402-104122424 CAATCTGAGTGGTAGGAAATGGG - Intergenic
995250178 5:109984202-109984224 CAGGGGTAGTGGTGGGAAATGGG + Intergenic
995780276 5:115767890-115767912 CAGGAGGAGAGGGAGGAAATGGG - Intergenic
996462423 5:123761565-123761587 CACGAGGTGTGGTAAGAAATGGG + Intergenic
997979238 5:138458838-138458860 AAGAAGGAGTGGGTGGAAGTGGG - Intergenic
998698600 5:144670231-144670253 CAGAAGTAGTGATGCGAAATTGG + Intergenic
999198590 5:149800129-149800151 TAGTAGGAGTTGGAGGAAATAGG - Intronic
999583483 5:153065020-153065042 CGGTAGGAGTGCTAGGCAATGGG + Intergenic
1000646982 5:163770957-163770979 AATAAGGAGTGGGAGGAATTTGG - Intergenic
1001535072 5:172492448-172492470 CATGAAGAGTGGTAGGAGATGGG + Intergenic
1003806705 6:9733447-9733469 CTGAAGGACTGGTAGGATTTGGG + Intronic
1003990343 6:11480567-11480589 GAGAAGGAGTGGGAGGAAAAGGG + Intergenic
1004342174 6:14817467-14817489 CAGATGGAGTGGGAGGAAAGGGG + Intergenic
1005695844 6:28352094-28352116 CAAAAGGAGTGGGAGGGAATGGG - Intronic
1005737230 6:28759242-28759264 CAGAAGGAGGTGTAGAAAAGGGG + Intergenic
1007247405 6:40472434-40472456 CAGAAGAAGTGGGAGGATTTAGG + Intronic
1007931645 6:45697132-45697154 CATAGGGAGTAGTAGAAAATGGG + Intergenic
1008303930 6:49877333-49877355 CAGAAGGAGAGAGAGCAAATGGG + Intergenic
1009499891 6:64398253-64398275 CAGAAGGAGAGGGATTAAATAGG + Intronic
1010173969 6:73004840-73004862 CAGAAGCAGGGGGAGGAAAACGG + Intronic
1011865298 6:91818420-91818442 CAGAATGAATGGTAGAAAGTGGG - Intergenic
1011923304 6:92610239-92610261 AAGAAGGAGGGGAAGGAAAGAGG - Intergenic
1011923314 6:92610288-92610310 AAGAAGGAGGGGAAGGAAAGAGG - Intergenic
1013034725 6:106370290-106370312 CAGAAGAAGGGGTACGAAGTAGG - Intergenic
1014914957 6:127135488-127135510 CAGTAGTAGTAGTAGGAAATGGG + Intronic
1016020366 6:139230554-139230576 CACAAGAAGTGGTAGCAAACAGG - Intergenic
1016347962 6:143136291-143136313 CAAAGGAAGTGGTAGGAAGTGGG - Intronic
1018305753 6:162453422-162453444 GAGAATGAGAGGTAGGAAAAAGG + Intronic
1018541069 6:164879818-164879840 GAGAATGAGTGGTAAGAGATGGG - Intergenic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1020649449 7:10856379-10856401 CAAAAGGAATGTTACGAAATGGG + Intergenic
1021815357 7:24442202-24442224 TACAAGGAGGGGTAGAAAATGGG - Intergenic
1023083330 7:36545874-36545896 CGGAGGCAGTGGTGGGAAATGGG - Intronic
1023558603 7:41449172-41449194 CAGGAGGAGTGGATGGGAATAGG + Intergenic
1024037940 7:45524357-45524379 CAGAAGGAGGTCTAGGAAAGAGG + Intergenic
1025775825 7:64560066-64560088 CAGAAAATGTGGTAGGTAATTGG - Intronic
1025941833 7:66080853-66080875 CCAAGGGAGTGGTAGGAATTGGG + Intronic
1026128989 7:67605072-67605094 CAGGCAGAGTGTTAGGAAATTGG - Intergenic
1026516087 7:71073798-71073820 AAGAAGAAGAGGTATGAAATAGG + Intergenic
1027514497 7:79125148-79125170 CAGAGGCAGTGGTAAGAAAAGGG + Intronic
1028952113 7:96648235-96648257 TAGAAGGAGTAGCAGGATATAGG + Intronic
1029853929 7:103494152-103494174 CTGAAGGAGTGGTAGCATTTGGG + Intronic
1030907888 7:115209030-115209052 CAGCAGAGGTGGCAGGAAATAGG + Intergenic
1031969736 7:128055409-128055431 CAGCAGGGGAGGAAGGAAATGGG + Intronic
1032703568 7:134403323-134403345 AAGAAGGTGTGGAAGGCAATAGG + Intergenic
1034164970 7:149018730-149018752 GGGCAGGAGTGTTAGGAAATGGG - Intronic
1034686117 7:152972823-152972845 AAGAAAGAGTGGGAGGAAATTGG + Intergenic
1035496648 7:159333493-159333515 GAGAAGTAGTGGTAGGGAAATGG - Intergenic
1036806377 8:11837152-11837174 GAGAAGGAGTGGTATGAGACTGG + Intronic
1037294679 8:17387563-17387585 CAGAAGGATTGTTAGTATATCGG + Intronic
1038646023 8:29363118-29363140 TAGAGGGAGAGGTTGGAAATGGG - Intergenic
1040807926 8:51415205-51415227 CAGTAGGAATTGTAGAAAATTGG + Intronic
1044291870 8:90481435-90481457 AAGAGAGAGTGGTAGAAAATGGG + Intergenic
1046004821 8:108466221-108466243 AAGAAGCAATGGTAGTAAATGGG + Intronic
1047822865 8:128540532-128540554 CATAATGACTGGTATGAAATAGG + Intergenic
1047946132 8:129882704-129882726 CAGAACGAGCTGTAGGAAAATGG - Intronic
1048240415 8:132736118-132736140 CAGAAGGATTGTAAGGGAATTGG + Intronic
1049107160 8:140621295-140621317 CAGTAGGAGGGGCAGGAAAGTGG - Intronic
1049820678 8:144631321-144631343 CAGAAGGACAGGCAAGAAATGGG - Intergenic
1051818325 9:21135239-21135261 CTCAAGGAGTGTGAGGAAATAGG - Intergenic
1051924682 9:22309635-22309657 CAGAAGAAGTGGCAGGATTTGGG - Intergenic
1056376882 9:86023388-86023410 GCAAAGGAATGGTAGGAAATAGG + Intergenic
1057097705 9:92326903-92326925 GAGAAGAATTGGTAGAAAATGGG + Intronic
1057642949 9:96844955-96844977 CAGGAGGAGTGGCAGCACATGGG - Exonic
1059874368 9:118617877-118617899 AAGAAGAGGTGGTAGGAAGTGGG - Intergenic
1062306357 9:135908909-135908931 TGGAAGGACTGGTAGGAAATGGG + Intergenic
1203619040 Un_KI270749v1:101024-101046 GAGAAGGAGTTTTAGGAAATAGG - Intergenic
1203627176 Un_KI270750v1:34861-34883 CAGAAGGAGAGGTTGGACTTTGG + Intergenic
1185707207 X:2276778-2276800 GAGAAGGAGAGGGAGGAAATAGG + Intronic
1185707262 X:2277044-2277066 GAGGAGGAGAGGGAGGAAATAGG + Intronic
1185707372 X:2277580-2277602 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707391 X:2277669-2277691 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707410 X:2277758-2277780 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707430 X:2277847-2277869 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707449 X:2277936-2277958 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707488 X:2278112-2278134 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707508 X:2278201-2278223 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707547 X:2278377-2278399 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707567 X:2278466-2278488 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707587 X:2278555-2278577 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707607 X:2278644-2278666 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707645 X:2278824-2278846 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707664 X:2278913-2278935 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707683 X:2279002-2279024 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707703 X:2279091-2279113 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707722 X:2279180-2279202 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707741 X:2279269-2279291 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707874 X:2279876-2279898 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707894 X:2279965-2279987 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707914 X:2280054-2280076 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707934 X:2280143-2280165 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707972 X:2280323-2280345 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707991 X:2280412-2280434 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708010 X:2280501-2280523 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708030 X:2280590-2280612 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708049 X:2280679-2280701 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708068 X:2280768-2280790 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708238 X:2281549-2281571 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708258 X:2281638-2281660 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708278 X:2281727-2281749 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708298 X:2281821-2281843 AAGGAGGAGAGGGAGGAAATAGG + Intronic
1185708337 X:2281997-2282019 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708357 X:2282086-2282108 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1189333240 X:40155485-40155507 AAGGAGGAGTGGGAGGAAGTGGG + Intronic
1190014961 X:46818973-46818995 CAGGAGGAGAGGGAGAAAATTGG - Intergenic
1190262278 X:48805020-48805042 AAGAGGGAGGGGTAGGAGATGGG + Intronic
1190439475 X:50463196-50463218 GAGAAGGAGGGGTGGGAAAGAGG - Intronic
1193747631 X:85301056-85301078 CACAAGGAGAGGGAGGAAAGTGG + Intronic
1195982729 X:110597347-110597369 GGGAGGGAGTGGGAGGAAATTGG - Intergenic
1196712677 X:118779510-118779532 TAGAACGAGGGGAAGGAAATGGG + Intronic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1197286075 X:124596690-124596712 CAGAATGAATGGTATGAGATGGG + Intronic
1197768555 X:130074538-130074560 GAGAAGGTGTGGTAGAAAAAGGG - Intronic
1198934778 X:141894914-141894936 CCGAAGGGGTGGGAGGAAGTTGG + Intronic
1199595780 X:149504907-149504929 AAGAAGGAATGGTAGGAGAGAGG + Intronic
1201252754 Y:12075747-12075769 CAGAAGGAGTGATAGCACACTGG - Intergenic
1202232261 Y:22669555-22669577 CAGAGGTAGTAGGAGGAAATGGG - Intergenic
1202310895 Y:23526603-23526625 CAGAGGTAGTAGGAGGAAATGGG + Intergenic
1202559907 Y:26143991-26144013 CAGAGGTAGTAGGAGGAAATGGG - Intergenic