ID: 1069669369

View in Genome Browser
Species Human (GRCh38)
Location 10:70188880-70188902
Sequence TGCCATGGGGATAGTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069669369_1069669376 5 Left 1069669369 10:70188880-70188902 CCCTGCACACTATCCCCATGGCA No data
Right 1069669376 10:70188908-70188930 TGTGGAGTTAAAGCTACAGCAGG No data
1069669369_1069669377 26 Left 1069669369 10:70188880-70188902 CCCTGCACACTATCCCCATGGCA No data
Right 1069669377 10:70188929-70188951 GGACACAGCATGACATTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069669369 Original CRISPR TGCCATGGGGATAGTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr