ID: 1069670827

View in Genome Browser
Species Human (GRCh38)
Location 10:70201649-70201671
Sequence ACACCACCATCCGTAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069670827_1069670837 16 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670837 10:70201688-70201710 AGGTGGGTGTGATTATAAAAGGG No data
1069670827_1069670832 -7 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670832 10:70201665-70201687 GTGGTGTGCAGAAGACAGGGGGG No data
1069670827_1069670830 -9 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670830 10:70201663-70201685 TGGTGGTGTGCAGAAGACAGGGG No data
1069670827_1069670829 -10 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670829 10:70201662-70201684 ATGGTGGTGTGCAGAAGACAGGG No data
1069670827_1069670833 -4 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670833 10:70201668-70201690 GTGTGCAGAAGACAGGGGGGAGG No data
1069670827_1069670834 -1 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670834 10:70201671-70201693 TGCAGAAGACAGGGGGGAGGTGG No data
1069670827_1069670835 0 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670835 10:70201672-70201694 GCAGAAGACAGGGGGGAGGTGGG No data
1069670827_1069670836 15 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670836 10:70201687-70201709 GAGGTGGGTGTGATTATAAAAGG No data
1069670827_1069670831 -8 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670831 10:70201664-70201686 GGTGGTGTGCAGAAGACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069670827 Original CRISPR ACACCACCATCCGTAACCCC TGG (reversed) Intergenic