ID: 1069670830

View in Genome Browser
Species Human (GRCh38)
Location 10:70201663-70201685
Sequence TGGTGGTGTGCAGAAGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069670827_1069670830 -9 Left 1069670827 10:70201649-70201671 CCAGGGGTTACGGATGGTGGTGT No data
Right 1069670830 10:70201663-70201685 TGGTGGTGTGCAGAAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069670830 Original CRISPR TGGTGGTGTGCAGAAGACAG GGG Intergenic