ID: 1069670830 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:70201663-70201685 |
Sequence | TGGTGGTGTGCAGAAGACAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1069670827_1069670830 | -9 | Left | 1069670827 | 10:70201649-70201671 | CCAGGGGTTACGGATGGTGGTGT | No data | ||
Right | 1069670830 | 10:70201663-70201685 | TGGTGGTGTGCAGAAGACAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1069670830 | Original CRISPR | TGGTGGTGTGCAGAAGACAG GGG | Intergenic | ||