ID: 1069672507 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:70220218-70220240 |
| Sequence | GCATAATTGCAGGCCAGGTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069672507_1069672510 | 16 | Left | 1069672507 | 10:70220218-70220240 | CCGCACCTGGCCTGCAATTATGC | No data | ||
| Right | 1069672510 | 10:70220257-70220279 | TTTTTTTTTTTTTTGAGACAAGG | 0: 13494 1: 16907 2: 33917 3: 145359 4: 149502 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069672507 | Original CRISPR | GCATAATTGCAGGCCAGGTG CGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||