ID: 1069672507

View in Genome Browser
Species Human (GRCh38)
Location 10:70220218-70220240
Sequence GCATAATTGCAGGCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069672507_1069672510 16 Left 1069672507 10:70220218-70220240 CCGCACCTGGCCTGCAATTATGC No data
Right 1069672510 10:70220257-70220279 TTTTTTTTTTTTTTGAGACAAGG 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069672507 Original CRISPR GCATAATTGCAGGCCAGGTG CGG (reversed) Intronic
No off target data available for this crispr