ID: 1069672510

View in Genome Browser
Species Human (GRCh38)
Location 10:70220257-70220279
Sequence TTTTTTTTTTTTTTGAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359179
Summary {0: 13494, 1: 16907, 2: 33917, 3: 145359, 4: 149502}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069672506_1069672510 19 Left 1069672506 10:70220215-70220237 CCACCGCACCTGGCCTGCAATTA 0: 1
1: 16
2: 229
3: 1495
4: 7413
Right 1069672510 10:70220257-70220279 TTTTTTTTTTTTTTGAGACAAGG 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
1069672507_1069672510 16 Left 1069672507 10:70220218-70220240 CCGCACCTGGCCTGCAATTATGC No data
Right 1069672510 10:70220257-70220279 TTTTTTTTTTTTTTGAGACAAGG 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
1069672509_1069672510 6 Left 1069672509 10:70220228-70220250 CCTGCAATTATGCTTATAAAAAG 0: 1
1: 0
2: 2
3: 20
4: 263
Right 1069672510 10:70220257-70220279 TTTTTTTTTTTTTTGAGACAAGG 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
1069672508_1069672510 11 Left 1069672508 10:70220223-70220245 CCTGGCCTGCAATTATGCTTATA 0: 1
1: 0
2: 3
3: 24
4: 266
Right 1069672510 10:70220257-70220279 TTTTTTTTTTTTTTGAGACAAGG 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069672510 Original CRISPR TTTTTTTTTTTTTTGAGACA AGG Intronic
Too many off-targets to display for this crispr