ID: 1069676899

View in Genome Browser
Species Human (GRCh38)
Location 10:70255035-70255057
Sequence GCCTCCCGCTGCGGAATGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 68}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069676899_1069676918 20 Left 1069676899 10:70255035-70255057 CCGCCCATTCCGCAGCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1069676918 10:70255078-70255100 CTGCTAGGGCCCGACTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 63
1069676899_1069676909 -8 Left 1069676899 10:70255035-70255057 CCGCCCATTCCGCAGCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1069676909 10:70255050-70255072 CGGGAGGCGGCCGGGCCTGGGGG 0: 1
1: 1
2: 6
3: 119
4: 952
1069676899_1069676912 6 Left 1069676899 10:70255035-70255057 CCGCCCATTCCGCAGCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1069676912 10:70255064-70255086 GCCTGGGGGCCCCACTGCTAGGG 0: 1
1: 0
2: 1
3: 27
4: 313
1069676899_1069676908 -9 Left 1069676899 10:70255035-70255057 CCGCCCATTCCGCAGCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1069676908 10:70255049-70255071 GCGGGAGGCGGCCGGGCCTGGGG 0: 1
1: 0
2: 4
3: 88
4: 681
1069676899_1069676917 19 Left 1069676899 10:70255035-70255057 CCGCCCATTCCGCAGCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1069676917 10:70255077-70255099 ACTGCTAGGGCCCGACTCAGAGG 0: 1
1: 0
2: 0
3: 3
4: 86
1069676899_1069676907 -10 Left 1069676899 10:70255035-70255057 CCGCCCATTCCGCAGCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1069676907 10:70255048-70255070 AGCGGGAGGCGGCCGGGCCTGGG 0: 1
1: 0
2: 5
3: 38
4: 409
1069676899_1069676911 5 Left 1069676899 10:70255035-70255057 CCGCCCATTCCGCAGCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1069676911 10:70255063-70255085 GGCCTGGGGGCCCCACTGCTAGG 0: 1
1: 0
2: 3
3: 50
4: 451
1069676899_1069676919 28 Left 1069676899 10:70255035-70255057 CCGCCCATTCCGCAGCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1069676919 10:70255086-70255108 GCCCGACTCAGAGGGCAGCCCGG 0: 1
1: 1
2: 1
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069676899 Original CRISPR GCCTCCCGCTGCGGAATGGG CGG (reversed) Exonic