ID: 1069679084

View in Genome Browser
Species Human (GRCh38)
Location 10:70270896-70270918
Sequence CTATACACCCTGATCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069679084_1069679091 20 Left 1069679084 10:70270896-70270918 CCAAGAGAGATCAGGGTGTATAG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1069679091 10:70270939-70270961 CCAGCAGTGTCAGCATCACCTGG 0: 8
1: 58
2: 295
3: 837
4: 1711
1069679084_1069679087 -9 Left 1069679084 10:70270896-70270918 CCAAGAGAGATCAGGGTGTATAG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1069679087 10:70270910-70270932 GGTGTATAGTTCTCAAAGAGGGG No data
1069679084_1069679092 30 Left 1069679084 10:70270896-70270918 CCAAGAGAGATCAGGGTGTATAG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1069679092 10:70270949-70270971 CAGCATCACCTGGAACTCATTGG No data
1069679084_1069679086 -10 Left 1069679084 10:70270896-70270918 CCAAGAGAGATCAGGGTGTATAG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1069679086 10:70270909-70270931 GGGTGTATAGTTCTCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069679084 Original CRISPR CTATACACCCTGATCTCTCT TGG (reversed) Intronic
904544952 1:31262216-31262238 CTAGACAAGCTGATTTCTCTTGG - Intronic
907618291 1:55947851-55947873 CTGTACCCCTTTATCTCTCTAGG + Intergenic
907920966 1:58911260-58911282 CTTTCCACCCTCATCTTTCTAGG + Intergenic
909493309 1:76249044-76249066 CTATATACCCTAATCTCTCAGGG - Intronic
910778698 1:90902837-90902859 CTTATCACCCTGAGCTCTCTGGG - Intergenic
911618768 1:100042927-100042949 ATAAACACCCTGATGTTTCTAGG - Intronic
917833153 1:178914594-178914616 CTAGATACTCAGATCTCTCTTGG + Intronic
918822783 1:189278523-189278545 CTTTTCATCCTAATCTCTCTTGG - Intergenic
920433759 1:205935413-205935435 CAATTCACCCGGGTCTCTCTGGG - Intronic
921600681 1:217103305-217103327 CTAGACTCCCTGAGCTGTCTGGG - Intronic
922220388 1:223553739-223553761 CTTTACTCCCTGAGGTCTCTAGG - Intronic
1067824562 10:49560858-49560880 CTTTGCCCCCTGAACTCTCTGGG + Intergenic
1069679084 10:70270896-70270918 CTATACACCCTGATCTCTCTTGG - Intronic
1072560348 10:96567490-96567512 CCACACACCCTGTGCTCTCTTGG + Intronic
1073197699 10:101706635-101706657 CTATAAACCCACATCACTCTTGG + Intergenic
1078703370 11:13712967-13712989 TTATACACCATGATGTTTCTTGG - Exonic
1080763155 11:35272183-35272205 CCATCCTCTCTGATCTCTCTAGG - Intronic
1085546539 11:77323595-77323617 CTATACAAACTAATTTCTCTTGG - Intronic
1087742644 11:101906982-101907004 CTATACATCCTGATCATCCTAGG - Intronic
1091601815 12:1922444-1922466 CCATACAGCCTGTTCTCTCCAGG - Intergenic
1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG + Intronic
1095619144 12:44228244-44228266 CAAGTCACCATGATCTCTCTCGG - Intronic
1096402590 12:51319444-51319466 CTGTACACCCTGTTCCCTCAAGG - Intronic
1096556408 12:52406672-52406694 TTATACACCCTGGCTTCTCTGGG + Intergenic
1097947423 12:65386979-65387001 CTATATATCCTGATATTTCTTGG + Intronic
1100585339 12:95974655-95974677 CTATCCACACTGAATTCTCTGGG - Intronic
1100661861 12:96708132-96708154 ATATACACCCTCAACTCCCTGGG - Intronic
1101137184 12:101756267-101756289 CTATAAACCCTGTTCTCGTTTGG - Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1109059148 13:57591021-57591043 CTCTACACAATGATATCTCTGGG - Intergenic
1110852911 13:80264860-80264882 CAATAGACCCTGAGCTCTGTGGG + Intergenic
1122358618 14:101142291-101142313 CTATACTCAATGATCTCTATTGG + Intergenic
1126561163 15:50045708-50045730 CTTTACCACCTAATCTCTCTGGG + Intronic
1127775110 15:62258344-62258366 CAATATTCTCTGATCTCTCTGGG - Intergenic
1131033336 15:89204811-89204833 GTATACACCTTGATTTCTCAAGG - Intergenic
1133425711 16:5687312-5687334 CTACACACCTTTGTCTCTCTCGG - Intergenic
1133532494 16:6667994-6668016 GTATACTCTCTGATCTCACTAGG - Intronic
1134422998 16:14111982-14112004 CCATCCCCCCTGATCTCTCAAGG + Intronic
1140353173 16:74281990-74282012 CTACACACCACGGTCTCTCTGGG + Intergenic
1141243699 16:82287052-82287074 CTAAAAACCCTGGTGTCTCTGGG - Intergenic
1143851238 17:9813631-9813653 CCTCACACCCTGCTCTCTCTCGG + Intronic
1146436686 17:32856358-32856380 CTATTCACACTCAACTCTCTTGG + Intronic
1147529755 17:41264665-41264687 CCATTCACCCTGATTTGTCTGGG - Intergenic
1150333276 17:64311636-64311658 CTAGAAAACCTGATTTCTCTGGG + Intergenic
1156968430 18:43125346-43125368 CTTTCCACCCTAATTTCTCTAGG - Intergenic
1158913956 18:62100780-62100802 CTCTTCACCCTTATCTCTTTTGG + Intronic
1162940999 19:14009133-14009155 CTCTACAACCTTATCTCTCCTGG - Intergenic
1168699552 19:58428709-58428731 CTGTACACCCTTATCTCACTTGG + Intergenic
925232190 2:2243358-2243380 CTATACAAACTTATCTCTCAAGG + Intronic
929047166 2:37801292-37801314 CTTTACACTCATATCTCTCTTGG - Intergenic
932055754 2:68441702-68441724 CTATACTCTATGTTCTCTCTGGG + Intergenic
936531913 2:113282458-113282480 CTATGTACCCTGGTTTCTCTGGG + Intergenic
937432961 2:121855796-121855818 CAGTACAGCCTGATCTCGCTGGG + Intergenic
938158713 2:128964027-128964049 CTATAGATCGTGATTTCTCTTGG + Intergenic
945910628 2:215644841-215644863 CTATACACCCAGGGCTATCTGGG - Intergenic
947156346 2:227165274-227165296 CACTAAACCCTGACCTCTCTGGG + Intronic
1170966306 20:21074961-21074983 CTGATCACCCTGTTCTCTCTGGG + Intergenic
1172393929 20:34585697-34585719 CTTCCCATCCTGATCTCTCTAGG - Intronic
1177199725 21:17940719-17940741 AGATACACCCTGATTTCTCTTGG - Intronic
1178767130 21:35465008-35465030 CCATTCACCCTGCTCTCACTGGG + Intronic
1179430615 21:41318608-41318630 CCATCCACCCTCATCTCTCCTGG + Intronic
1183729532 22:39610148-39610170 CTTTACACTCTGATCTATCCTGG + Intronic
949488609 3:4565623-4565645 CAATACAGCCTGCTCTCTGTGGG - Intronic
949765758 3:7524004-7524026 CTAGCCTCCGTGATCTCTCTAGG - Intronic
951772515 3:26274446-26274468 CTATACAACCAGATCTCACAAGG - Intergenic
955640097 3:61073187-61073209 CCATCCATCCTGATCTATCTAGG - Intronic
956214448 3:66833964-66833986 TTAAACAACCAGATCTCTCTCGG + Intergenic
959575612 3:107929661-107929683 TTGTACACCGTGATCTCTCTGGG + Intergenic
960933464 3:122878691-122878713 ATATTCACAGTGATCTCTCTGGG + Intronic
961315976 3:126035902-126035924 CTATTTCCCCTGATATCTCTAGG - Intronic
962341994 3:134593623-134593645 CTATACACATTGATTTCACTTGG - Intergenic
967223693 3:187271236-187271258 CAAAACAGCCTGATCTATCTTGG - Intronic
974426996 4:61754589-61754611 ATATACACTCAGATCTTTCTAGG - Intronic
975197554 4:71543197-71543219 GCATACACACTGATTTCTCTGGG - Intronic
975619372 4:76280666-76280688 CTCAACACCCTGAATTCTCTAGG + Intronic
986670277 5:10137530-10137552 CTCTTCCCCCTGATTTCTCTAGG + Intergenic
987175639 5:15305421-15305443 CTTTACATCCTGATGTCTTTAGG + Intergenic
987353748 5:17044319-17044341 CAATCCACCATCATCTCTCTTGG + Intergenic
993462882 5:88207227-88207249 CTATACACAATGATCTTTATAGG + Intronic
994632682 5:102305390-102305412 CTATACTCACTGATTTCTTTAGG - Intergenic
998299110 5:141001386-141001408 ATATACTCCCTGTTCTCTGTAGG - Intronic
1005772056 6:29083408-29083430 CTATATACAGTGATCTATCTGGG + Intergenic
1010681765 6:78807266-78807288 ATATAAACCCCCATCTCTCTGGG - Intergenic
1011898577 6:92262913-92262935 CTTTATCTCCTGATCTCTCTTGG - Intergenic
1014732571 6:125050801-125050823 CAACACACACTGATTTCTCTTGG + Intronic
1014872726 6:126615477-126615499 CCTTCCACCTTGATCTCTCTGGG + Intergenic
1022870778 7:34477052-34477074 CTATGCACCCTGAATACTCTTGG + Intergenic
1026368609 7:69675410-69675432 CTAGACACCTAAATCTCTCTAGG + Intronic
1026528596 7:71177172-71177194 TTACAGACACTGATCTCTCTTGG + Intronic
1026562947 7:71465532-71465554 CTATAGACTTTGATCTCTCCAGG + Intronic
1028336474 7:89663261-89663283 CTATAAAACCTGATGTTTCTTGG - Intergenic
1029734996 7:102460726-102460748 CTGTGCACCCTAATCTCTTTAGG + Intronic
1031141434 7:117947652-117947674 TTATACACTCTGGTCTCGCTTGG - Intergenic
1031562292 7:123253249-123253271 CCATTCTCCCTGAACTCTCTTGG - Intergenic
1038764619 8:30415648-30415670 CTATACTCCCAGGTCTGTCTTGG - Intronic
1042652461 8:71058247-71058269 CTATAGAAGCTGATCACTCTGGG + Intergenic
1042783325 8:72517589-72517611 TTCTTCACCCTCATCTCTCTTGG - Intergenic
1044921834 8:97176309-97176331 CTCTACACCCTCTTTTCTCTGGG + Intergenic
1048387405 8:133925027-133925049 CTATACACCGACATCTTTCTAGG - Intergenic
1053151214 9:35744412-35744434 CTAACCACCCTGATTTCTCTAGG - Exonic
1055372006 9:75610405-75610427 CAACACACCCAGTTCTCTCTGGG - Intergenic
1055398534 9:75898679-75898701 CTATAAAACCTGATCTCTAGTGG - Intronic
1060906675 9:127313290-127313312 GGATGGACCCTGATCTCTCTCGG - Intronic
1187050101 X:15687394-15687416 GTATAGACACTGAGCTCTCTTGG - Intergenic
1187112554 X:16316538-16316560 CTATCCACACTTATCTCCCTAGG + Intergenic