ID: 1069684609

View in Genome Browser
Species Human (GRCh38)
Location 10:70309675-70309697
Sequence TTCCCCAGTTTCTCCAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069684599_1069684609 14 Left 1069684599 10:70309638-70309660 CCCCTTCTCCCCATCCGCTACTG 0: 1
1: 0
2: 1
3: 22
4: 319
Right 1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG No data
1069684601_1069684609 12 Left 1069684601 10:70309640-70309662 CCTTCTCCCCATCCGCTACTGAA 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG No data
1069684602_1069684609 6 Left 1069684602 10:70309646-70309668 CCCCATCCGCTACTGAAGACCAC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG No data
1069684603_1069684609 5 Left 1069684603 10:70309647-70309669 CCCATCCGCTACTGAAGACCACT 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG No data
1069684600_1069684609 13 Left 1069684600 10:70309639-70309661 CCCTTCTCCCCATCCGCTACTGA 0: 1
1: 0
2: 2
3: 15
4: 221
Right 1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG No data
1069684604_1069684609 4 Left 1069684604 10:70309648-70309670 CCATCCGCTACTGAAGACCACTG 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG No data
1069684605_1069684609 0 Left 1069684605 10:70309652-70309674 CCGCTACTGAAGACCACTGATCC 0: 1
1: 0
2: 2
3: 12
4: 135
Right 1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069684609 Original CRISPR TTCCCCAGTTTCTCCAGAGG AGG Intronic
No off target data available for this crispr