ID: 1069684969

View in Genome Browser
Species Human (GRCh38)
Location 10:70312125-70312147
Sequence AGGTAACCAGAATTGCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069684966_1069684969 15 Left 1069684966 10:70312087-70312109 CCTGGGGAAGTGTCAAGGGAGGT 0: 1
1: 0
2: 2
3: 10
4: 217
Right 1069684969 10:70312125-70312147 AGGTAACCAGAATTGCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069684969 Original CRISPR AGGTAACCAGAATTGCTAGC TGG Intronic
No off target data available for this crispr