ID: 1069685115

View in Genome Browser
Species Human (GRCh38)
Location 10:70312962-70312984
Sequence AGAGGAGGAATGAAAGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 1, 2: 4, 3: 60, 4: 539}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069685115_1069685131 22 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685131 10:70313007-70313029 GGTGGGCTAATGGGCATTGAGGG No data
1069685115_1069685132 23 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685132 10:70313008-70313030 GTGGGCTAATGGGCATTGAGGGG No data
1069685115_1069685133 24 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685133 10:70313009-70313031 TGGGCTAATGGGCATTGAGGGGG No data
1069685115_1069685124 4 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685124 10:70312989-70313011 CCCAGGTTGGCCAGCAAGGGTGG No data
1069685115_1069685130 21 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685115_1069685127 12 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685127 10:70312997-70313019 GGCCAGCAAGGGTGGGCTAATGG No data
1069685115_1069685126 5 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685126 10:70312990-70313012 CCAGGTTGGCCAGCAAGGGTGGG No data
1069685115_1069685117 -9 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685117 10:70312976-70312998 TCCTCCTCTGTGCCCCAGGTTGG No data
1069685115_1069685121 1 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685121 10:70312986-70313008 TGCCCCAGGTTGGCCAGCAAGGG No data
1069685115_1069685128 13 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685128 10:70312998-70313020 GCCAGCAAGGGTGGGCTAATGGG No data
1069685115_1069685120 0 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT 0: 1
1: 1
2: 4
3: 60
4: 539
Right 1069685120 10:70312985-70313007 GTGCCCCAGGTTGGCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069685115 Original CRISPR AGAGGAGGAATGAAAGCCAA AGG (reversed) Intronic
902141651 1:14361682-14361704 AGAGGATGAACAGAAGCCAAGGG - Intergenic
902244052 1:15107713-15107735 AGAGGAGGAATGGGAGGCAGCGG - Intronic
902775392 1:18671360-18671382 AGAGGAGGAAAGAAAAGAAATGG + Intronic
903617848 1:24675182-24675204 AGTGGAGGAATAAAAGCCTACGG - Intergenic
904203612 1:28837986-28838008 AGAGGAGGAAAGTAAGCCTTGGG - Intronic
905052655 1:35065197-35065219 GGAGGAGGAAGGGAAGACAATGG - Intronic
906265891 1:44429075-44429097 AGAGTAGGAATGAAAGTGCAGGG - Intronic
906691203 1:47793807-47793829 AGAGGAAAAATGAAAGGCAAAGG + Intronic
907669034 1:56458488-56458510 AATGGAGGAATGAATGGCAAAGG - Intergenic
908310302 1:62874729-62874751 AGAGGATTAATGATTGCCAATGG + Intergenic
908454465 1:64289481-64289503 AGAGCAGGAAAGAAAACCATGGG + Intergenic
908808085 1:67951394-67951416 AGTGGAGGCAGAAAAGCCAATGG - Intergenic
909940120 1:81601895-81601917 AGAGGCAGAATGAAAGAAAAAGG + Intronic
910285724 1:85552023-85552045 AGAGGTGGGATGAAATCCCAAGG + Intronic
910461087 1:87448625-87448647 AAAGCAGGAAAGAAAGCCAAAGG - Intergenic
910865870 1:91787645-91787667 AGAGGAAAACAGAAAGCCAAGGG + Intronic
911027515 1:93449476-93449498 AGGGTGGGAGTGAAAGCCAATGG + Intronic
911067394 1:93802705-93802727 AGAGGAGGAGTGAGAGACAGTGG + Intronic
911069934 1:93824607-93824629 AGAGGAGGCATGAGAACAAAGGG - Intronic
911234450 1:95396103-95396125 TAAGGAGGAAAGACAGCCAAAGG + Intergenic
911447145 1:98011339-98011361 ACAAGAAGAATGGAAGCCAAAGG - Intergenic
911572296 1:99532839-99532861 AGAGCAGGAATGAGAGGAAAGGG - Intergenic
911648333 1:100359354-100359376 AGAGCAGGGATGCAAGCCAGAGG + Intronic
911922504 1:103783654-103783676 AGAGGGAGAATGAAGGACAAAGG - Intergenic
912114524 1:106388737-106388759 AGAAAAGGAATGAAAATCAATGG - Intergenic
912200872 1:107456123-107456145 GGATGAGCAATGAAAGACAAAGG + Intronic
912624027 1:111193101-111193123 AGAAGAGCCATGAAAGCCAGGGG - Intronic
912946843 1:114092571-114092593 ATAGGAAGAATGAAAAACAAAGG - Intronic
912970324 1:114275373-114275395 AGAGGAGAAATGGAACCCACTGG + Intergenic
913692674 1:121294095-121294117 AGAGTAGGAAGCAAAGCCAAAGG - Intronic
914022475 1:143882606-143882628 AATGGAGGAAGGAAAGGCAAAGG - Intergenic
914144882 1:144985995-144986017 AGAGTAGGAAGCAAAGCCAAAGG + Intronic
914660959 1:149790548-149790570 AATGGAGGAAGGAAAGGCAAAGG - Intronic
915036940 1:152935719-152935741 AGAGGAGGAAGGATATTCAATGG - Intergenic
915168543 1:153962431-153962453 AAAGGAGGAGGGAAAGGCAAGGG - Intronic
915326715 1:155084655-155084677 ATGGGAGGGATGGAAGCCAAGGG - Intronic
916581234 1:166111148-166111170 AGAGGAGATATGAAAGAGAAGGG - Intronic
917139170 1:171817658-171817680 AGAGGAGGGATGACAGAGAAAGG + Intergenic
917606150 1:176631944-176631966 AGAGGGGGAGTGTAAGCAAAAGG + Intronic
918335825 1:183511755-183511777 AGTGGAGGAAACAAAGCCAAGGG + Intronic
918379900 1:183943499-183943521 AGAGGAAAAATGAAAGGGAAGGG + Intronic
918457002 1:184731576-184731598 TGAGGAGGAAGGACAGCCAGTGG - Intronic
918624693 1:186643996-186644018 AGAGAAGCATTGAAAGCAAAAGG - Intergenic
919413942 1:197283005-197283027 AGATGAGCAATCAGAGCCAAAGG + Intronic
920278240 1:204824446-204824468 ACAGGTGCAGTGAAAGCCAATGG - Intergenic
920286848 1:204885781-204885803 AGATGAGCAGTGAATGCCAAAGG - Intronic
920479994 1:206312456-206312478 AGAGTAGGAAGCAAAGCCAAAGG - Intronic
920748251 1:208649281-208649303 TGAGAGGGAATGAGAGCCAAGGG - Intergenic
921597556 1:217070988-217071010 AGAGAAGGAAAGAAAGAGAAAGG - Intronic
921847553 1:219900164-219900186 AGAGGAGAAATGGAATACAATGG + Intronic
921867387 1:220100032-220100054 AATGGAGGAATCAAAGGCAAAGG - Intronic
922203977 1:223430806-223430828 GGAGGAGGCATGAATGCTAAGGG + Intergenic
922430043 1:225542360-225542382 CCAGGAGGAATCAAACCCAAAGG + Intronic
923051355 1:230393195-230393217 GGAGGAGGCAGGGAAGCCAAGGG + Intronic
923095301 1:230770684-230770706 AGAGGAGGACAAGAAGCCAAAGG + Intronic
923344982 1:233042901-233042923 AAAGGAGGAATGAAAGAAGAAGG + Intronic
924017008 1:239738261-239738283 AGAGAAGGAATGAAGGGCATGGG - Intronic
924043681 1:240008074-240008096 GGAGGAGGAAAGAAGGACAAAGG - Intergenic
924467637 1:244312732-244312754 AGAGGAGGAAGGAAAGGGAAAGG - Intergenic
924702879 1:246472088-246472110 AAAGGAAAAATGAAAACCAAAGG + Intronic
1063096575 10:2913649-2913671 AGAGTAGGAAGGAAAGCAAAGGG + Intergenic
1064471792 10:15642801-15642823 AGAGGAGAGAAGAAAGCCAAAGG + Intronic
1064524077 10:16234881-16234903 GGAGGAGGAAAGAAAGCTAATGG + Intergenic
1064633803 10:17343582-17343604 AGAGGAGGAAAGAAAAGTAATGG + Intronic
1065155445 10:22865254-22865276 AGAGGAGGAATGAAAATGAATGG - Intergenic
1065187535 10:23183447-23183469 AGAGGAGAAATGAAAAGCACTGG + Intergenic
1066272318 10:33835868-33835890 AGAGGAGGAATTTTAGGCAAAGG + Intergenic
1066452014 10:35538098-35538120 AGAGAGAGAATGAGAGCCAAGGG - Intronic
1069291551 10:66786360-66786382 AGAGGAGGAAGGAGAGCTGAAGG - Intronic
1069685115 10:70312962-70312984 AGAGGAGGAATGAAAGCCAAAGG - Intronic
1071372636 10:84968196-84968218 AGAGTAGGGATGAAATCCATGGG + Intergenic
1072779270 10:98234525-98234547 AAAGGAAGATTGAAAGCCACTGG - Intronic
1073373589 10:103012890-103012912 AGAGAAGGAAGGAAAGGCTATGG - Intronic
1073603830 10:104873270-104873292 TAAGGAAGAATGAAAACCAAGGG - Intronic
1073630340 10:105141833-105141855 AGAGCTGGAATGAAAGCTCAGGG - Intronic
1073740900 10:106405709-106405731 AGATGAGTAATAAATGCCAAGGG + Intergenic
1073756085 10:106582170-106582192 ATAGGAGGAAGGAAAGAGAAGGG - Intronic
1074025084 10:109626095-109626117 AGAAAAGCAATGAAAGACAAGGG + Intergenic
1074238024 10:111605986-111606008 AAAGGAGGAATAAAAGGGAAGGG - Intergenic
1075293620 10:121252959-121252981 AGAGGATGAATGAAAGGCAGGGG - Intergenic
1075585453 10:123653828-123653850 AGAGGAGGAAGGGAAGGGAAGGG + Intergenic
1075591486 10:123694606-123694628 AGAGAAGGAAGGAAAAACAAAGG + Exonic
1077682457 11:4255591-4255613 AGAGGAAGAATGACTGCTAATGG - Intergenic
1078325621 11:10378531-10378553 AGAGGAGGAAAGATGGCCAGAGG + Intronic
1078664234 11:13311243-13311265 AGATGTGGAATGGAAGCCATAGG + Intronic
1079085998 11:17445328-17445350 AGATGAGGAGTGACTGCCAATGG + Intronic
1079838039 11:25359287-25359309 AGAGGAGGAACATAAGGCAAAGG + Intergenic
1080844025 11:36010660-36010682 AATGGAGGCATGAAAGCAAATGG - Intronic
1080892597 11:36422366-36422388 AGATGAGGAATGGAACCCAGGGG + Intronic
1083653092 11:64215209-64215231 GGAGGAGGAATGACTGCAAATGG - Intronic
1083774578 11:64888149-64888171 GGAGGAGGAAGGAATGCCAGGGG - Intronic
1083880234 11:65544805-65544827 AGAGGAGGGAGGAGAGCCAGCGG - Intronic
1084506796 11:69573421-69573443 AGAGGAGCCATGAAATCCAAGGG + Intergenic
1084799997 11:71537446-71537468 AGAAGAGGTAAGAAAGACAAAGG + Intronic
1084947555 11:72646741-72646763 AGAGGTGGAAGAAAAGCCAGAGG - Intronic
1085709072 11:78812780-78812802 AGTGGAGGACTGAAAGGCAAGGG - Intronic
1085771058 11:79326263-79326285 ATAGGAGAAATGGAAGCCAAGGG - Intronic
1085846034 11:80066175-80066197 ACAAGAGGATTCAAAGCCAAAGG + Intergenic
1086250499 11:84807008-84807030 AGAGGAGGAATTAAACAAAAAGG + Intronic
1087020855 11:93601676-93601698 AGAGAAAGCATGAAAGGCAAAGG + Intergenic
1087784056 11:102334264-102334286 AGAGTAGGAATGAAAAGTAATGG - Intronic
1087796695 11:102461605-102461627 AAAGAAGGAATAGAAGCCAAAGG + Intronic
1088043800 11:105422161-105422183 AAAGAAGGATTGAAAGTCAAAGG - Intergenic
1088465278 11:110128549-110128571 AGAGAAGGAAGAAAACCCAAGGG + Intronic
1088762777 11:112948236-112948258 AGAGGGGGAAGCAAAGCCACAGG - Intergenic
1088804906 11:113343572-113343594 ACAGGAGGGAAGAAAGCCAAGGG + Intronic
1088826604 11:113500432-113500454 TGAGGAAAAATGAATGCCAATGG + Intergenic
1089272487 11:117311615-117311637 AGAGTAGGACTGAAAGACACAGG - Intronic
1090755572 11:129787339-129787361 AGAGAAGGAGTGAATGCCATGGG + Intergenic
1090848691 11:130551542-130551564 AGAACAGGAATGAAGGCCAAGGG + Intergenic
1090994001 11:131848702-131848724 AGAGTTGGAATGAGAACCAAGGG - Intronic
1091291750 11:134444350-134444372 AGAGAGAGAATGAGAGCCAAGGG + Intergenic
1091298231 11:134488375-134488397 GGAGGTGGAATGAAAGACAAAGG - Intergenic
1091836016 12:3586329-3586351 AGACTAGGAAGGAAAGCCACTGG - Intronic
1091926239 12:4352741-4352763 AGAGAAGTAAATAAAGCCAATGG - Exonic
1091952115 12:4602539-4602561 AGTGGAGGGATATAAGCCAACGG + Intronic
1092069594 12:5621864-5621886 GGAGGAGGGATGAAAGGAAAGGG + Intronic
1092304822 12:7288627-7288649 AGAGGAGGCATGAAACCACAGGG - Intergenic
1093270831 12:17058858-17058880 AAAGGAGGCAGGAAAGACAAAGG + Intergenic
1093345073 12:18030389-18030411 ACAGGTGTGATGAAAGCCAAAGG - Intergenic
1093729345 12:22549845-22549867 TGAGGAAGAATCAAAGGCAAGGG - Intergenic
1094220171 12:27984533-27984555 AGTGGAGGAATCAGAACCAAAGG + Intergenic
1094560533 12:31548876-31548898 AGAGTACTACTGAAAGCCAAGGG + Intronic
1094778014 12:33754553-33754575 AGTGGATGAATGAAAGTTAATGG + Intergenic
1095436748 12:42197262-42197284 AGAGGAGGGTTCATAGCCAAAGG - Intronic
1095490245 12:42725884-42725906 TGAGGAGGAAAGAAGGGCAAGGG + Intergenic
1095491884 12:42743627-42743649 AATGGTGGATTGAAAGCCAAAGG + Intergenic
1096466923 12:51851779-51851801 TGAGGAGGAAGGAAAGAAAAGGG + Intergenic
1097331522 12:58336999-58337021 AGAGGAAAAAGGAAAACCAAAGG - Intergenic
1098115143 12:67167388-67167410 AGAAGAGTAATGAAATACAAAGG - Intergenic
1098190544 12:67943843-67943865 AGAGAAGGAATGAGAACCAGGGG + Intergenic
1098881586 12:75922779-75922801 AGAGGAAGAAACTAAGCCAATGG - Intergenic
1099063003 12:77935836-77935858 AGAGGAAGAGAGAGAGCCAAGGG + Intronic
1099861498 12:88229737-88229759 AGTGCAGCAATGAAGGCCAATGG + Intergenic
1100594209 12:96057740-96057762 AGAGTAGGATTGAAAGGGAAGGG + Intergenic
1100646009 12:96532296-96532318 AGAGGAGGGAGAAAAGCCTAGGG + Intronic
1100728993 12:97442684-97442706 GGAGGAGAAATGAAATACAAGGG - Intergenic
1101559775 12:105845357-105845379 AGAGTAGGAATGAAAGGTAATGG + Intergenic
1101651453 12:106681179-106681201 AATGAAGGAATGAAAGCCTAGGG - Intronic
1101702949 12:107192535-107192557 AGAGGAGAAATCAAAGCTCATGG - Intergenic
1101877351 12:108604549-108604571 AGAGCAGGAGGAAAAGCCAAGGG + Intergenic
1102421093 12:112803355-112803377 AGAGGATGAATTAAGGCCCATGG + Intronic
1102561091 12:113762791-113762813 AGAGGAGGAATAAAATCCTGGGG - Intergenic
1104056832 12:125237069-125237091 AGAGAAGGGAGGAAGGCCAATGG - Intronic
1104849470 12:131864562-131864584 AGAGGTGGGAGGAAAGACAATGG + Intergenic
1106006184 13:25772183-25772205 CGAGGAGAATGGAAAGCCAAGGG - Intronic
1107347120 13:39473454-39473476 AGTGAAAGACTGAAAGCCAACGG + Intronic
1107863314 13:44681678-44681700 AGATGTGGAAAGAAAGACAACGG + Intergenic
1108030866 13:46228242-46228264 AGAGAAGGCATGCAAGCTAATGG + Intronic
1108105748 13:47006822-47006844 TGAGGAGGGATAAAAGCCACAGG - Intergenic
1108889419 13:55234604-55234626 AGAGAGAGAATGAAAACCAAGGG - Intergenic
1108978816 13:56483797-56483819 AGGGAAGGAATGAAAGCAATAGG - Intergenic
1109020751 13:57088811-57088833 AGAAGAGACATGCAAGCCAAGGG - Intergenic
1109498758 13:63211042-63211064 AAAGGAGGAAGGAAAGTCAAGGG - Intergenic
1109758749 13:66798377-66798399 AGAGGAGAAAGGAAGACCAAAGG - Intronic
1111613009 13:90628685-90628707 AGAAGAGGAAGAAAAGCCAAAGG - Intergenic
1111693047 13:91589238-91589260 AGAAGAGGAATGAGAGTCAAAGG - Intronic
1111793441 13:92887756-92887778 GGAGGAAAAATAAAAGCCAATGG + Intergenic
1112537115 13:100270148-100270170 GGAGGAAGAAGAAAAGCCAAAGG + Intronic
1112757552 13:102655046-102655068 AGAGGGAGAATGACAGCCAGTGG + Intronic
1113010610 13:105761633-105761655 AGAGGAAGAATGAAAACCTGTGG - Intergenic
1113273197 13:108698039-108698061 AGAGGAGGAATGAAGGCAGAGGG - Intronic
1114466700 14:22928292-22928314 AGAGTAGAAATGAGAGACAAAGG + Intronic
1114710860 14:24776861-24776883 AGAAGAAAAATGAAAACCAAGGG + Intergenic
1114859855 14:26503334-26503356 AAAGGAAGAATGAAAGCCAAAGG + Intronic
1116065167 14:39972913-39972935 AAAGGAGGAAAGAGAGCAAAAGG + Intergenic
1116578861 14:46612126-46612148 AGAGGTATAAAGAAAGCCAAGGG - Intergenic
1117074748 14:52090772-52090794 AGGGAAGGAAGGAAAGTCAATGG + Intergenic
1117547888 14:56808372-56808394 AGAGGAGGAAAGAAAGAAAAAGG + Intronic
1117666490 14:58061578-58061600 ACAGGAGAAATGAAAGCCATGGG + Intronic
1118686995 14:68301212-68301234 AGAGGATGAAAGAAATCCAGTGG + Intronic
1118927589 14:70206904-70206926 TGAGGAGAAAAGAAGGCCAAGGG - Intergenic
1119210579 14:72828663-72828685 TGAGGAGCAATGAAGGGCAAAGG + Intronic
1119687684 14:76645562-76645584 ATAGGAGGACTCAAAGCCAGGGG + Intergenic
1121032632 14:90672166-90672188 AGAGAAGGAAGGAAAGCACAAGG + Intronic
1121787333 14:96672118-96672140 AGTGGAGGAAGGAAACCCACAGG + Intergenic
1121831331 14:97054766-97054788 AGAGCAGGAAAGAAAGAGAAAGG + Intergenic
1124089162 15:26581568-26581590 AAAGGAGGGATGAAGGCCCAGGG - Intronic
1124803670 15:32860058-32860080 AAAGGAGGAAAGAAAGGCAAAGG + Intronic
1125129914 15:36272055-36272077 AAAGGAAGAATGAATGGCAATGG + Intergenic
1125211062 15:37215748-37215770 AGAGAAGAAATGAAGGCCTAAGG + Intergenic
1126012461 15:44316439-44316461 AGAGGAAGGGTTAAAGCCAAAGG + Intronic
1126121188 15:45252936-45252958 AGAAGAGAAATGAAAGGCAGTGG - Intronic
1127669144 15:61177999-61178021 AAAGAAGGAAAGAAGGCCAAAGG + Intronic
1128384048 15:67134626-67134648 GGAGGAGGAAAGAAAGCCCAAGG - Intronic
1128488052 15:68116617-68116639 AGAAGAGAAATGAAACCCAAAGG - Intronic
1128565019 15:68695347-68695369 AGAGGAGGGAAGAAGGGCAAAGG - Intronic
1128791221 15:70435353-70435375 AGAGGAGGAAAGAATGCAATTGG + Intergenic
1129088009 15:73117848-73117870 AGAGAAGGAAGGAAAGAAAAGGG - Intronic
1129168229 15:73791438-73791460 AGAGGAGAAATGAAAACAAGTGG + Intergenic
1129504019 15:76065943-76065965 AGAGGAGGGAAGAATGCCGAGGG + Intronic
1130295448 15:82644710-82644732 GGAGGAGGAAAGAAAGGTAATGG - Intronic
1130513514 15:84608124-84608146 AGAGGGGGAATGAAAGAGAAAGG - Intronic
1131533429 15:93214018-93214040 AGAGGAGGGGTGGAAACCAAAGG - Intergenic
1133551302 16:6856922-6856944 AGAGAAGGAAAGAAAACGAACGG + Intronic
1133841908 16:9417528-9417550 AGAGGAGAAATCAAAGCTGAAGG + Intergenic
1134504071 16:14791096-14791118 AGCAAAGGAATGAAAGCCAGGGG + Intronic
1134576501 16:15337812-15337834 AGCAAAGGAATGAAAGCCAGGGG - Intergenic
1134596297 16:15498677-15498699 AAAGGAGGAAAGAAAGAAAAAGG + Intronic
1134613775 16:15632959-15632981 AGAGCAGTAATGAAAATCAAAGG + Intronic
1134725942 16:16418687-16418709 AGCAAAGGAATGAAAGCCAGGGG + Intergenic
1134941492 16:18293172-18293194 AGCAAAGGAATGAAAGCCAGGGG - Intergenic
1135205720 16:20482308-20482330 AGAGGAGGGATTTGAGCCAAAGG + Intronic
1135213196 16:20541501-20541523 AGAGGAGGGATTTGAGCCAAAGG - Intronic
1135393872 16:22116215-22116237 AGAGAAGGAAGGAAAGAGAAAGG + Intronic
1135706039 16:24675920-24675942 AGAGTAGGAAGAAAAACCAAGGG - Intergenic
1135863645 16:26080531-26080553 AGAGAAGGCAGGAAAGCAAATGG + Intronic
1135928941 16:26720185-26720207 ACTGGAGAAATGATAGCCAAAGG + Intergenic
1136247372 16:28983755-28983777 AGAGGAGACAGGAAAGCCAGGGG - Intronic
1136379168 16:29884021-29884043 AGAAGAGGAATGAATGTGAAGGG - Intronic
1137376985 16:47960229-47960251 AGAGGAGGAATGGAAGGAAGAGG + Intergenic
1137989424 16:53138465-53138487 AGAAAAGGAAGGAAAGCCATAGG + Intronic
1138099934 16:54244390-54244412 AGAGGAAGGAGGAAAGCCAGCGG - Intergenic
1138111510 16:54327904-54327926 AGAGAAAGGATGAAAGCCCACGG - Intergenic
1139304886 16:65976774-65976796 AGAGGAAAAATGAAAGGAAAAGG - Intergenic
1140174510 16:72643233-72643255 AGAAGAGAAGTGAAAGCAAAAGG - Intergenic
1140285085 16:73595438-73595460 AAAGGAGTCATGGAAGCCAAGGG - Intergenic
1140672450 16:77292470-77292492 TGAGCAGGAATCAAAGCAAAAGG - Intronic
1140837782 16:78811448-78811470 AGAGGAGAAAGGAAAGGGAAAGG - Intronic
1142992531 17:3740937-3740959 AGAGGGGGAATGACAGCCCAGGG + Intronic
1143539088 17:7558871-7558893 GGAGGAGGAAAGCAAGCTAAGGG - Exonic
1143888780 17:10086534-10086556 AGAGTTTGAGTGAAAGCCAAAGG + Intronic
1143919162 17:10317274-10317296 AGAGGAAGAAAGAAAACCAAGGG + Intronic
1143947443 17:10605538-10605560 GGAGGAGTAAGGAAAACCAAAGG + Intergenic
1144258877 17:13498367-13498389 AGAGTAGGATTGAAAGACAGAGG - Intronic
1145102883 17:20091392-20091414 AGAGGAAGAATGAGAGCCCTGGG - Intronic
1145189019 17:20822288-20822310 TGGGGAGGAATGAATGGCAAAGG + Intergenic
1146001346 17:29132396-29132418 AGAGGAGAAATTAAATCCATAGG - Intronic
1146312061 17:31776844-31776866 AGTAGAGGAATGTAAGCCAGTGG - Intergenic
1146699618 17:34945074-34945096 CAAGGAGGCATTAAAGCCAAGGG - Intronic
1146905715 17:36616681-36616703 AGATGAGGCATGTAAGCCCATGG - Intergenic
1148505720 17:48125672-48125694 GGAGAAGGAAAAAAAGCCAAGGG + Intergenic
1148980123 17:51566501-51566523 ACACCAGGAATCAAAGCCAAGGG - Intergenic
1149456726 17:56794337-56794359 AGAGGAGAAATGAAATTCACTGG + Intronic
1149937547 17:60823748-60823770 ACATGGAGAATGAAAGCCAATGG + Intronic
1150028841 17:61709527-61709549 AGAAGAGTATTGAAAGTCAATGG + Intronic
1150877174 17:68983139-68983161 AGAGGAGGAATGAAAGACAAAGG + Intronic
1150973296 17:70055244-70055266 AGAGGACGAAAGAAATCTAAAGG - Intronic
1151105691 17:71614172-71614194 AGAGTAGAAAAGAAAGCCCAAGG - Intergenic
1152265603 17:79292731-79292753 AGCGGAGGAAAGAAAGCAAAAGG - Intronic
1154504542 18:15022107-15022129 AAAGAGGGAATGAGAGCCAAGGG + Intergenic
1155034602 18:22015384-22015406 AGAGGAGGAAGGAAAGTCTCAGG - Intergenic
1155519053 18:26651188-26651210 ACAGGAGGAATGGAAGCCGGTGG + Intronic
1156257593 18:35412386-35412408 AGAGGAGTCATCAAAGCCATGGG - Intergenic
1156356052 18:36340989-36341011 AGAGGAAGAAAGGAAGGCAAAGG - Intronic
1156360439 18:36380132-36380154 AAAGGAGGAAAGAAAGGCATTGG + Intronic
1156385804 18:36603992-36604014 ACAGGAGGAATGACAGCAAGAGG - Intronic
1156587497 18:38447520-38447542 AGAGGAGGAAGAAGAGCCCAGGG - Intergenic
1156743903 18:40366236-40366258 AGAGAAGAAAAGCAAGCCAATGG + Intergenic
1158528088 18:58233410-58233432 AAGAGAGAAATGAAAGCCAAGGG + Intronic
1158609887 18:58929504-58929526 AGAGCAGGACCAAAAGCCAAGGG - Intronic
1158856482 18:61547615-61547637 AGATGAGGAAAGTAAGCAAATGG + Intronic
1158870418 18:61681796-61681818 TCAGGAGTAAGGAAAGCCAAAGG + Intergenic
1159631750 18:70756786-70756808 TGAGGAGGAGTTAAAGACAATGG - Intergenic
1160052100 18:75443413-75443435 AGAGGTGGAAGGAAAGACAAAGG + Intergenic
1163716969 19:18878514-18878536 TGGGGAGGAAGGAACGCCAAGGG - Exonic
1164130296 19:22355560-22355582 AAAGCAGAAATGAAACCCAAAGG - Intergenic
1166059908 19:40319840-40319862 ACAGCTGGAATCAAAGCCAAGGG - Exonic
1166071762 19:40392305-40392327 AGAGGAGGCGTGGAAGCCATGGG + Intergenic
1167607314 19:50488409-50488431 AGAAGAGGAAAGAAAGACGAGGG + Exonic
1167698316 19:51027580-51027602 AGAGAGGGGAGGAAAGCCAAGGG - Exonic
1167733716 19:51278342-51278364 AGAGCTCGAATGAAAGGCAAGGG + Intergenic
1168413792 19:56156447-56156469 CCTGGAGGAAAGAAAGCCAAAGG - Intronic
1168487802 19:56779410-56779432 AGAGGAGGAATCATATGCAATGG - Exonic
925417765 2:3683536-3683558 AGATGAGGGATGATAGCTAAAGG - Intronic
926481433 2:13400807-13400829 AGAGGAGGAAGGAAATTCCAGGG + Intergenic
926658530 2:15437890-15437912 AGAGGCAGAATGAGAACCAAGGG + Intronic
926709659 2:15868550-15868572 ACAGGAACAACGAAAGCCAAAGG + Intergenic
927812081 2:26185835-26185857 AGAGGACAAAGGAAAGCCGAAGG - Intronic
928976670 2:37094484-37094506 AGAGGACAAATGGAAGCTAAAGG - Intronic
930288502 2:49465254-49465276 AAAGGAGGAAGGAAAGGAAAAGG - Intergenic
930397371 2:50840420-50840442 AGCGGTGAAATGAAAGACAAGGG - Intronic
930516644 2:52416290-52416312 GGATAAGGAAAGAAAGCCAAGGG + Intergenic
930980250 2:57516570-57516592 AGAGAAGGACTGAGAGACAAAGG - Intergenic
931528721 2:63188279-63188301 AAAGGAGGAAAGAAAGAGAAAGG - Intronic
931853948 2:66282025-66282047 AGAGGAGGAAGGACAGTAAAGGG - Intergenic
932042856 2:68319028-68319050 AATGGAGGAATACAAGCCAAAGG + Intronic
933003269 2:76954522-76954544 AAAAGAGGGATGAAAGCCAAAGG + Intronic
933342977 2:81046577-81046599 AGAGGAGCAATGAATTCCACTGG - Intergenic
934648523 2:96073262-96073284 TGGGGAGGAATGAAAGGGAAGGG + Intergenic
934653229 2:96104150-96104172 AGAGGAGGAAGGGAAGGAAAAGG - Intergenic
935523096 2:104133869-104133891 AGAGGAGGGATAAATGCCCATGG + Intergenic
935737030 2:106114470-106114492 AGATGAGGAAAGAAAGTGAATGG + Intronic
936270772 2:111046892-111046914 TGAGGAGGAATGCAGGCCATAGG + Intronic
937445904 2:121957619-121957641 AGAGGAGGTAGGAAAGTCACAGG + Intergenic
937662589 2:124447347-124447369 ATCGGAAGAATGAAAGTCAAAGG - Intronic
938503730 2:131852313-131852335 AAAGAGGGAATGAGAGCCAAGGG + Intergenic
938603321 2:132865623-132865645 AAAGAAGGATTGAAATCCAACGG - Intronic
938754902 2:134370760-134370782 AGAGGAGAAATAAAATGCAAAGG + Intronic
938841416 2:135168565-135168587 AGAGGAGGAATTGAAGAGAATGG + Exonic
939289094 2:140170032-140170054 AGAGGAAGAATACAAGCCAGAGG - Intergenic
939437007 2:142190301-142190323 ATAGAAGGAATGCAAGGCAAAGG - Intergenic
939654945 2:144812578-144812600 CGTGGAGGAATGAAAACCTATGG - Intergenic
941117395 2:161487835-161487857 AGAGCAAGAATGGCAGCCAAGGG - Intronic
941451611 2:165666758-165666780 AGAGGAAGAAAGAAAGAGAAAGG + Intronic
942447050 2:176085189-176085211 AGAGAAGGAAGAAAAGCAAAGGG - Intergenic
942617635 2:177810642-177810664 AGAAGAGAAATGAGAGCCAGGGG + Intronic
942818403 2:180080543-180080565 AGGGGAGGAAGGAAAGGGAAAGG - Intergenic
943853965 2:192764322-192764344 AGATAAAGAATGAAACCCAAGGG - Intergenic
943894322 2:193333947-193333969 TGAGAAGGAATAAAAGCCAGTGG + Intergenic
944169506 2:196759435-196759457 AGGGGAGGAAGGAACGCAAAGGG - Intronic
945690241 2:213025080-213025102 AGAGGATTAATAAAAGCCTATGG - Intronic
946284013 2:218688970-218688992 AGAGGAGGAAAGAAAATAAAAGG - Intronic
947243120 2:228017893-228017915 AGAGGAAGAAAGAGAGCCAGGGG - Exonic
947467726 2:230368548-230368570 AGAGGAGAAGAGAAAGACAAAGG - Intronic
948790409 2:240373872-240373894 AGATGAGGAATCAAAAACAAGGG + Intergenic
1170484593 20:16803694-16803716 AGAGAAGAGATGAGAGCCAAGGG - Intergenic
1170966546 20:21077509-21077531 AGAAGAGCAAAGAAAGCCCATGG + Intergenic
1171103932 20:22413566-22413588 AGAGGAGGAAGCACAGCCACTGG + Intergenic
1171232307 20:23497312-23497334 AGAGGAGGAATGAATCCCTTTGG + Intergenic
1172320520 20:33992835-33992857 AGCTGAGGAATGAAGGACAACGG + Intergenic
1173827775 20:46058369-46058391 AGAGGAGGGTGGGAAGCCAAGGG - Intronic
1174298586 20:49566763-49566785 TGAGGAGGTATGAAAACTAAAGG + Intronic
1175249926 20:57603104-57603126 AGAGAGAGAATGAGAGCCAAGGG - Intergenic
1176268687 20:64224078-64224100 ACTGGAGGCATGAAAACCAAAGG - Intronic
1176662705 21:9654198-9654220 AAAAGTGGAATGAAAACCAAAGG - Intergenic
1176920275 21:14679756-14679778 AGAAGAGGAAGGAAAAACAAAGG + Intergenic
1177009089 21:15709671-15709693 AAAGGAGGAAAGAAAGAAAACGG - Intergenic
1177055687 21:16298233-16298255 GAAGGAGGAATGCAAGCCGAAGG - Intergenic
1177895383 21:26851266-26851288 AGAGGAGGAAGCAAATACAATGG - Intergenic
1177992691 21:28057833-28057855 AAAGAGGGAATGAGAGCCAAGGG - Intergenic
1178050636 21:28743120-28743142 ACAGGAGGGATGAGACCCAAAGG + Intergenic
1178700496 21:34829420-34829442 AGAGAAGAAATGAAAACCAGTGG - Intronic
1179035962 21:37759034-37759056 AGAGGAGGACTTAAAAGCAATGG - Intronic
1179477200 21:41654678-41654700 ACAGAGGGAATGACAGCCAAGGG + Intergenic
1179487408 21:41719278-41719300 AGAGGCTGAATGACACCCAAGGG - Intergenic
1181909306 22:26225829-26225851 AGTTGAGAAGTGAAAGCCAAGGG - Intronic
1182348963 22:29687771-29687793 AGAGGGGGAAGGAAAGAAAAAGG + Intronic
1182838399 22:33363397-33363419 AGAGAAAGAATGAGACCCAAGGG + Intronic
1182902556 22:33910525-33910547 AGGGGATGAGTGAAAGTCAAAGG - Intronic
1183248439 22:36711440-36711462 AGAGGAGGAAGGGAAGGGAATGG + Intergenic
1183435578 22:37792618-37792640 AGAAGAGGAAAGAAAGAAAAAGG + Intergenic
1184021577 22:41825200-41825222 AGAGGAGGGAGGACAGCCAAGGG + Intronic
1184350434 22:43939998-43940020 AGTGAAGAAATGAAAGACAAAGG + Exonic
1184522588 22:45004094-45004116 AGAGGGGAAGTGACAGCCAAGGG + Intronic
1184950659 22:47840468-47840490 GGACGAGGAAGGAAAGGCAAAGG - Intergenic
949749191 3:7331225-7331247 AGAGGAGGCATGAAGGCTTATGG + Intronic
949909567 3:8890639-8890661 AGAGGAGGAGCAAAGGCCAAAGG + Intronic
950741041 3:15052063-15052085 AGAGGAAGATTCAAAGCCAGCGG + Exonic
951336229 3:21425586-21425608 AGGGCAGGAGTGAAAGGCAAAGG - Exonic
951537850 3:23755870-23755892 AAAGGAGGAAAGAAAGCCTTTGG - Intergenic
952148880 3:30564768-30564790 AAAGGAGGAAAGAAAGGCAGGGG - Intergenic
952569254 3:34694533-34694555 AGAGGAAGAAAGAAAGGAAAAGG - Intergenic
952803852 3:37326740-37326762 AGAGGAGGAGTTAAAGGCATTGG + Exonic
952820617 3:37482788-37482810 AGAGGAGAAAGAAAAACCAAAGG - Intronic
952839507 3:37632300-37632322 AAGGGAGGAATGAAAGGCAAGGG + Intronic
953093923 3:39756421-39756443 TGAAAAAGAATGAAAGCCAAAGG + Intergenic
953718965 3:45338841-45338863 AGAGGAAGAAGGAAAGAGAAAGG + Intergenic
954099761 3:48360908-48360930 AGAAGACGAATGAGAGCAAAGGG - Intergenic
954377564 3:50203199-50203221 AAAGGAAGAAGGAGAGCCAAGGG + Intergenic
954455281 3:50594821-50594843 AGGGAAGGAAAGGAAGCCAAAGG - Intergenic
954711925 3:52509415-52509437 GGAGGAGGGACGAAGGCCAAGGG + Intronic
954711948 3:52509501-52509523 GGAGGAGGGACGAAGGCCAAGGG + Intronic
955215599 3:56982802-56982824 AGAGGAGGAAGGACAGCCAGGGG - Intronic
955347284 3:58170496-58170518 AGAGGAAATATGAGAGCCAAAGG - Intronic
955881963 3:63556288-63556310 AGAGGAGGAAGGAAGGGGAAAGG - Intronic
956046778 3:65203989-65204011 AGGGGAGGAATCAAAGTAAATGG + Intergenic
956473330 3:69592749-69592771 AGAAGAACAATCAAAGCCAAAGG + Intergenic
956885564 3:73555742-73555764 AGAGGTGAAAGGAAAGTCAATGG + Intronic
957312821 3:78541995-78542017 AGCGGAAGAATGAAAGGAAAGGG - Intergenic
957533972 3:81476925-81476947 GGAGGATGGCTGAAAGCCAACGG - Intergenic
957874610 3:86129544-86129566 ATAGGAGGAATGAAGACCATGGG - Intergenic
958468783 3:94492559-94492581 AGAGCAGGAATGACAGACAGAGG + Intergenic
959129448 3:102335649-102335671 AGAAGAGGAAAAAAAGCCAGAGG - Intronic
960213396 3:114999099-114999121 AAAGGAGGAAGGAAAGGGAAGGG + Intronic
960306307 3:116065739-116065761 AGAGGAGGAATATAAACAAAAGG - Intronic
960737136 3:120793186-120793208 AGAGGAGGGAAGAAAATCAAGGG - Intergenic
960795312 3:121479920-121479942 ATAGGAAGAATCAAAGGCAAAGG + Intronic
960939253 3:122922689-122922711 AGAGGAGGGAGGAGAGCAAAGGG + Intronic
961150927 3:124637194-124637216 AGAGGAGGACTGCAAGACATCGG - Intronic
963182833 3:142378187-142378209 ACAGGAGAAAGGAAAGCCACTGG + Intronic
963529368 3:146454759-146454781 AAAGGAGAAATGAAAAACAAAGG + Intronic
964436182 3:156656218-156656240 AGAGAAGTTATGAAAGTCAAAGG + Intergenic
964754794 3:160083388-160083410 AGAGTAAGAATGAAAGGTAAAGG - Intergenic
964869878 3:161301960-161301982 AGAGGAAGCCGGAAAGCCAAGGG + Intergenic
965609943 3:170532949-170532971 AGAGGAGGCATAACACCCAAAGG - Intronic
967387718 3:188927643-188927665 AGAAAAGGAATGAAAGGCAAAGG - Intergenic
967515670 3:190365787-190365809 AGGGGAGGAATGGAACACAATGG - Intronic
967550834 3:190794015-190794037 AAAGAAGGATTGAAAGGCAAAGG + Intergenic
967669922 3:192220562-192220584 AGAGGCGGAATAAAAACCTAAGG - Intronic
969610616 4:8225829-8225851 AGAGGAGGCCTGGAAGCCAGTGG + Intronic
970177127 4:13350583-13350605 AGAGGGAGAATCAAGGCCAAGGG + Intergenic
970363002 4:15328906-15328928 GGAGTAGGACTGAAAGCAAAGGG - Intergenic
971296029 4:25392860-25392882 AGACAAGGAATCACAGCCAAGGG - Intronic
971681550 4:29707023-29707045 TGAGAAGAAATCAAAGCCAAAGG - Intergenic
971814798 4:31473872-31473894 AGAGGATGAATGAGAGAAAATGG - Intergenic
972654380 4:41050723-41050745 AGAAGAGGAAGGAAAGAGAAAGG + Intronic
972987135 4:44778321-44778343 AGAGCAGGAATGAAAGAAAGAGG - Intergenic
972991702 4:44828549-44828571 AAAGGAGAAATGAAATCCACAGG - Intergenic
973192028 4:47396216-47396238 AGAGAGAGAATGAGAGCCAAGGG + Intronic
974146451 4:57953560-57953582 AGAGAAGGAAGGAAAGTGAAGGG + Intergenic
974751097 4:66142354-66142376 AGAGGAGGAAGGAAAGGGAGAGG - Intergenic
974980768 4:68954674-68954696 AAAGGAAGAAAGAAAGCTAATGG - Intergenic
975798337 4:78032622-78032644 AGGGTTGGAATGACAGCCAAGGG + Intergenic
977139613 4:93351956-93351978 AGAGGATGAATGAAAGTGTAAGG - Intronic
977424400 4:96848212-96848234 AGAGGAGGAAAGAGAACCACAGG - Intergenic
977603572 4:98959655-98959677 AAAGGGGGAATCATAGCCAATGG + Intergenic
978686481 4:111451090-111451112 TGAGGAGGAAAGCAAGACAAAGG - Intergenic
978848320 4:113302168-113302190 ACATGAGGAATGAAAGGCAGTGG + Intronic
979002125 4:115235140-115235162 AAATGAGAAAAGAAAGCCAATGG + Intergenic
979358502 4:119733522-119733544 AGAGGCGGACTGAAATGCAAGGG - Intergenic
979770621 4:124520767-124520789 AGCAGAGGAAAGAAAGCTAAAGG + Intergenic
980627197 4:135388894-135388916 AGATGAGAAAGGAAAGCCCATGG - Intergenic
981253364 4:142630172-142630194 AGAAGAGGCATGAAAACCAAGGG + Intronic
981552080 4:145952175-145952197 ACAGGATGTAGGAAAGCCAAGGG + Intergenic
982165914 4:152613660-152613682 AGAGGAGGAAAGAAAGAGGAAGG - Intergenic
982204059 4:152983906-152983928 AAAGAAGGAAATAAAGCCAATGG - Intergenic
982334992 4:154225349-154225371 AGAGGAGGAGTGGAAGCTAGAGG - Intergenic
982609409 4:157554514-157554536 AGAGAAGGCATGAAGGGCAATGG + Intergenic
984671208 4:182489875-182489897 AGAGGAGGAAAGAAAGAGGAAGG - Intronic
984702831 4:182829076-182829098 GGAGGAGGAAGGAAAGCCCTCGG + Intergenic
985306526 4:188548089-188548111 ACAGAAGTAATGAAAGCCACTGG - Intergenic
985412631 4:189701983-189702005 AAAAGTGGAATGAAAACCAAAGG + Intergenic
986760884 5:10878659-10878681 AGAGGAAACATGAAAGCTAAAGG - Intergenic
986828699 5:11551067-11551089 AGAGGAGGGATGGAAGCCCAGGG - Intronic
986874925 5:12096121-12096143 AGAGGAAGAATGAGAGGCAGTGG + Intergenic
987396826 5:17432052-17432074 GGAGGAGGAAGGAAAGGGAAGGG - Intergenic
987849024 5:23324915-23324937 TGAGCAGGACTGATAGCCAATGG + Intergenic
988696263 5:33625471-33625493 AGTGAAGGAATGAAGGCCACTGG - Intronic
989127172 5:38066564-38066586 AAAGGACAAATGAAAGCAAATGG + Intergenic
989443200 5:41496263-41496285 AGAGGAGAAATGAGAAACAAAGG + Intronic
990052211 5:51517692-51517714 AGAGTCGGAATGAATGACAAAGG + Intergenic
990522333 5:56592143-56592165 AGAAGAGTAATGAAAGGAAAAGG - Intronic
990672086 5:58143366-58143388 AGAGCTGGGATGGAAGCCAATGG + Intergenic
991313614 5:65274452-65274474 AGTTGAGGAATAAAAGCAAAAGG - Intronic
992640347 5:78763484-78763506 TGAGGAGGAATGAGAGGGAAGGG + Intronic
994116841 5:96070865-96070887 AGAGGAGGAATGCTCGCCCAAGG + Intergenic
994242216 5:97437189-97437211 AGAAGAGAAAGGAAAGCCAAGGG - Intergenic
994251921 5:97545730-97545752 AGAGGAGAAAATAAAGACAAAGG - Intergenic
994435119 5:99719274-99719296 ATAGGAGGTATGTAAGCAAATGG + Intergenic
994954271 5:106507215-106507237 AATAGAGGAATGAAAGTCAAAGG + Intergenic
995048295 5:107673066-107673088 AGAGGAGGGCTGAAAGGCACAGG - Intergenic
995552506 5:113294857-113294879 AGAGAAGGAAAGAAAGCTAGAGG + Intronic
996153902 5:120074563-120074585 AGGAGAAGAATGAGAGCCAAGGG - Intergenic
996898791 5:128519869-128519891 AGAGAAGAAAAGGAAGCCAAGGG + Intronic
996981414 5:129500240-129500262 ATAGGAGGACTGAAAGTCATAGG - Intronic
997187887 5:131900586-131900608 AGAGGAGGAAGGCAAGCCTTGGG - Intronic
997883873 5:137613805-137613827 AGAGGAAGAAGGAAAGAAAAAGG + Intergenic
997900702 5:137761368-137761390 GCAGGAGGGATGGAAGCCAAAGG - Intergenic
997992656 5:138558713-138558735 ATAGAAAAAATGAAAGCCAAAGG + Intronic
998199430 5:140107875-140107897 GGAGGAGGAGGGAGAGCCAAGGG + Intronic
998471872 5:142389912-142389934 AGAGGAAGATTAAGAGCCAAGGG + Intergenic
999074114 5:148778827-148778849 ACAGTAGGTATGAAAACCAAAGG - Intergenic
999090476 5:148931793-148931815 AGAGGGGGAAGGAAAGCAAGGGG - Intronic
999491401 5:152055063-152055085 AGAAGAAGGATGAAAACCAAAGG + Intergenic
1000232692 5:159330814-159330836 CGAGGAAGAAGGAAGGCCAAGGG + Exonic
1000689774 5:164302638-164302660 AAAGGAGGATTGAAAGAAAAAGG - Intergenic
1001047213 5:168383486-168383508 TTAGGAGGAATGAGAGCTAAAGG + Intronic
1003123659 6:3338232-3338254 ACAGAAGAAATGAAAGCCCAAGG - Intronic
1003710951 6:8589655-8589677 CCAGAAGGAATGAAAGTCAAGGG + Intergenic
1004390812 6:15208147-15208169 AAAGGAGGAATGAGGGCCAGAGG - Intergenic
1004672594 6:17811830-17811852 AGAGAAGGAAAGAAAGAAAAAGG - Intronic
1004818687 6:19341638-19341660 AGGAGAAGAATGAAAGCCAGAGG - Intergenic
1005366255 6:25080698-25080720 AGAAGAGGAAGGAAACTCAAAGG - Intergenic
1005993136 6:30915721-30915743 AGAGGAAGAAAAAAAGTCAAAGG - Intronic
1005997096 6:30938211-30938233 AGAGGAAGAAGGAAGGCCAAAGG - Intergenic
1006474020 6:34243850-34243872 AGATGAGGAAAGGAAGCCATAGG + Intronic
1006696361 6:35933740-35933762 ACAGGTGGAATGAAAACCAGTGG + Intergenic
1007598467 6:43066583-43066605 AGAGGAAAAATGAAAGCCAAAGG - Intronic
1007660614 6:43483453-43483475 AGAGGAGGAAAGAAAAGCAGCGG - Intronic
1007835367 6:44669867-44669889 AGAGGAGGAAGGCAAGGCCAAGG + Intergenic
1008211254 6:48728256-48728278 AAAGGAGGAATAATAGCCAAGGG - Intergenic
1008369909 6:50720359-50720381 TGAGGAGGAAAGAAAACAAAGGG + Intronic
1008385991 6:50890576-50890598 AGAAGAGGAATCAAAGCAAAGGG + Intergenic
1008427257 6:51373865-51373887 AAAGGAATAATGAAAGCAAAAGG + Intergenic
1009509695 6:64534543-64534565 AGAAGCAGAATGAAAGCAAAAGG - Intronic
1009774065 6:68181823-68181845 AGAGGTGGAGGGAAAGACAATGG + Intergenic
1010314412 6:74429529-74429551 AGAGAAGCAATGGAAGCAAATGG - Intergenic
1011164211 6:84427714-84427736 AGAAGAGAAATGACAGCCATAGG + Intergenic
1011507604 6:88064338-88064360 ACAGGAGTAATGAAAGGCGATGG - Intronic
1011761843 6:90575714-90575736 AGAGGATTAATGAAAGCCAAGGG + Intronic
1011837808 6:91455967-91455989 AGCTGAGGATTTAAAGCCAATGG + Intergenic
1011974001 6:93269445-93269467 AGAGTAGGAATCCAAACCAAAGG + Intronic
1011977378 6:93320640-93320662 AGAGGTGCAATTAAAGCTAAGGG + Intronic
1011977819 6:93327904-93327926 AGATGAAGACTGAAAGCCATTGG - Intronic
1012256229 6:97035998-97036020 AAAGGAGTAAAGAAAGCCTATGG - Intronic
1012625461 6:101399537-101399559 AGAGAAGAAATGAAAGCACAAGG - Intronic
1013616581 6:111849233-111849255 ACTGCAGGAATGGAAGCCAAAGG + Intronic
1013747427 6:113362515-113362537 AGAGGAGGTATGACAGATAAAGG - Intergenic
1014351569 6:120352772-120352794 AGAGGAGGAAAGAAAAAGAAAGG + Intergenic
1014594181 6:123312277-123312299 AGAGGCGGAATAAATGCAAATGG - Intronic
1014850550 6:126335165-126335187 AGAGAAGTAAAGAAAGACAAAGG - Intergenic
1015079665 6:129208674-129208696 AGAGAAGGAAAGAAAGAAAAAGG + Intronic
1015707624 6:136105451-136105473 AGATGAGGAAGCAAAGCTAATGG - Intronic
1015954403 6:138584986-138585008 AGGAGAGAAATGAGAGCCAAGGG - Intronic
1016192048 6:141281312-141281334 AAAGCAGGGATGAAAGCCCAGGG - Intergenic
1016373344 6:143396279-143396301 AGAGGAGGAATAAAAGAAATGGG - Intergenic
1016404642 6:143717169-143717191 AGAGCAAGAAGAAAAGCCAAGGG - Intronic
1017075663 6:150615457-150615479 GGAGGAGTAAAGAAGGCCAAGGG - Intronic
1018044768 6:159956096-159956118 AGAGGAGGAAGGAAGGAAAAAGG + Intergenic
1018959670 6:168439439-168439461 AGATGAGGAACAAAAGTCAAAGG - Intergenic
1019144060 6:169965632-169965654 AGAAGAGGAATGAAAAGCACAGG + Intergenic
1019360802 7:603380-603402 AGAGCAGGAATGAAAGCAGAGGG + Intronic
1020151090 7:5682142-5682164 AAAAGGGGAAAGAAAGCCAACGG - Intronic
1021585607 7:22204171-22204193 AGAGGAGAAGTCAAAGCCATAGG - Intronic
1022711679 7:32856581-32856603 AGTGGAGGAATGAAAGCGAGGGG - Intergenic
1022912979 7:34918378-34918400 AGTGGAGGAATGAAAGCGAGGGG + Intergenic
1023048763 7:36233799-36233821 AGAGATGGAACAAAAGCCAACGG + Intronic
1023386845 7:39667006-39667028 AGAAGAGAAAGGAAAGCTAATGG - Intronic
1023989031 7:45117221-45117243 AGAGGAGGAATCAGACCCAAAGG + Intergenic
1026177087 7:68007443-68007465 ACAGGAAGAAAAAAAGCCAATGG + Intergenic
1027131118 7:75592146-75592168 GGAGAAGGAAAGAAAGACAAAGG + Intronic
1027234203 7:76288122-76288144 AGAAGAGGAAGGAAAGAAAAAGG + Intergenic
1028007789 7:85598726-85598748 AGAGGAGGAAAAAAAGAGAAGGG + Intergenic
1028789210 7:94834460-94834482 AGAGGAGCAATGAGAGCGAGAGG - Intergenic
1030129576 7:106186901-106186923 AGAGGAGCAAAGAAAGAGAAAGG - Intergenic
1030183026 7:106730737-106730759 AGAGGGGGAATGCAAGGAAAAGG - Intergenic
1030328376 7:108246458-108246480 GGAGCAGGAACAAAAGCCAAAGG + Intronic
1030713160 7:112777469-112777491 AGGGAAGAAATGAAGGCCAAAGG - Intronic
1031228812 7:119077377-119077399 ACAGGAAGACTGTAAGCCAAAGG - Intergenic
1032416286 7:131737815-131737837 AGAAGAGGAAGAAAAGCAAAGGG + Intergenic
1032493033 7:132339004-132339026 AGAGGAGGAATGGAAGCCCATGG + Intronic
1032516560 7:132510423-132510445 AGAGCAGTGCTGAAAGCCAAGGG + Intronic
1032584107 7:133130662-133130684 AGTGGATGAATGAATGCCATGGG + Intergenic
1032790942 7:135242055-135242077 AGAGGAGGAAGGAAAGAAAAAGG + Intronic
1033606727 7:142933074-142933096 AGAGGCAGAATGACAGCCAAGGG - Intronic
1034122859 7:148643260-148643282 AGAGGGGCAATGCAAGGCAAGGG - Intergenic
1034558052 7:151862487-151862509 AGAGGGGGAAAGAAAGAAAATGG - Intronic
1034610374 7:152361667-152361689 AGAAAAGGAATGAAAACAAATGG + Intronic
1036809737 8:11859360-11859382 GGAGGTGGAATGAAAGTCAAAGG + Intronic
1036978958 8:13446955-13446977 AAGGAAGGAATGAAAGACAACGG + Intronic
1037078577 8:14754164-14754186 AGAAGAGTAATGGAGGCCAATGG + Intronic
1038077043 8:24087944-24087966 AGAGGAAGAAAGAAAGCAAAAGG - Intergenic
1038348498 8:26754810-26754832 AGGGGGGAAATGAAAGCAAAAGG - Intronic
1038395260 8:27241714-27241736 GGAGGAAGGATGAAAGCCAGCGG - Exonic
1038412381 8:27368413-27368435 AGTGGAGGGATGAATACCAAGGG - Intronic
1038753454 8:30317927-30317949 AGAAGAGAAAAGAAAGCAAACGG + Intergenic
1039516031 8:38134399-38134421 AGAGGAGGTATCAAGTCCAAAGG + Intronic
1041217473 8:55615282-55615304 AGAGGAGAGCAGAAAGCCAAAGG + Intergenic
1041636195 8:60147594-60147616 AGAGGAGGAATGAAAGAAGGAGG - Intergenic
1041669093 8:60475308-60475330 AGAGGAGGAATAGGAGGCAAGGG - Intergenic
1042749348 8:72141105-72141127 AGAGGAGGGATGAACGCCTAGGG + Intergenic
1042939935 8:74097317-74097339 AGAGGAGGAAAGTAAGGCACAGG - Intergenic
1042959104 8:74283966-74283988 AGGGGAGGAATGTAAGGAAAAGG - Intronic
1045862974 8:106834012-106834034 AGAGGAGGAGTTAGAGCTAAGGG + Intergenic
1046773530 8:118139820-118139842 AGAGTTTGAATGAGAGCCAACGG - Intergenic
1046900604 8:119519837-119519859 TGTGGAGGAATGAATTCCAAGGG - Intergenic
1047561923 8:125995126-125995148 AGAGGAAGCATTAAAGCCAATGG + Intergenic
1047921446 8:129638852-129638874 ACAGGAGGAATCAAATCAAAGGG - Intergenic
1047938735 8:129807129-129807151 AGAAGAAGAAAGAAAGACAAGGG + Intergenic
1048367151 8:133748099-133748121 AGAGGAGGACTGAAGGACCATGG - Intergenic
1049277028 8:141725090-141725112 ACAGGAGGAGTGAAACCCACAGG - Intergenic
1049279560 8:141737399-141737421 AGTGCAGGAATGAAAGGCAGCGG - Intergenic
1049422907 8:142524767-142524789 AGAGCGGGAAGGAAAGCCCAAGG - Intronic
1049454522 8:142680320-142680342 AGAGGTGGAAAGAAGGACAAAGG + Intronic
1050184620 9:2959962-2959984 AAAGGAGGAAAAAAAGCTAAGGG + Intergenic
1050359080 9:4811406-4811428 GGAGAAGGAAGGATAGCCAAAGG - Intronic
1050593983 9:7187810-7187832 GGAGTAGGAATGTAATCCAAGGG - Intergenic
1050980079 9:11999065-11999087 AGACGAAGAATGAAAGTGAAGGG + Intergenic
1051611942 9:18969846-18969868 AGATGAGGAAGCAAGGCCAATGG + Intronic
1052419877 9:28229478-28229500 GGAGGAGGAAGGAAAGGTAAAGG + Intronic
1052567855 9:30181615-30181637 AGAGGAAGAAAGAAAGAGAAAGG - Intergenic
1053044030 9:34898940-34898962 AGCTGAGGAATTAGAGCCAAGGG + Intergenic
1053434405 9:38065969-38065991 ACAGGAGGGATGAAGGGCAAGGG - Intronic
1054909457 9:70440769-70440791 AGGGGAGGAAGGAAAGGGAAGGG + Intergenic
1056344791 9:85681305-85681327 AGGAGAGAAATGACAGCCAAAGG - Exonic
1056671126 9:88627658-88627680 AGATGAGGAGTGAATGCCAAGGG + Intergenic
1056930532 9:90872500-90872522 AGAGGAGGACAGAAAGCCTAGGG + Intronic
1056938334 9:90935090-90935112 AGAGGAGGAAAGCAAGGCATAGG - Intergenic
1057010512 9:91597339-91597361 AGATGAGGAAAGCAAGCCCAGGG - Intronic
1058957225 9:109960272-109960294 AGAGGAGGGCTGATAGCGAAAGG - Intronic
1059125871 9:111684219-111684241 AGAGGAGGAAAGAGAACCACTGG - Intergenic
1059229992 9:112711334-112711356 AAAGGAGCAACGGAAGCCAAAGG + Intronic
1059584314 9:115589817-115589839 AGAGGAGAACTGAAAGGCCATGG + Intergenic
1060746127 9:126132058-126132080 AGAGAAGGGAGGAAAGCCATGGG + Intergenic
1061499019 9:130991700-130991722 AGCGGGGGAGTGAAGGCCAAGGG - Intergenic
1061601896 9:131675681-131675703 AGAAGAGGAATTTAAGGCAAGGG + Intronic
1061942651 9:133891677-133891699 AGAGGAGGAATGGAAGGGGAGGG + Intronic
1062201856 9:135307145-135307167 AGAGGAGGAAGGAAAACCCCTGG - Intergenic
1062673975 9:137729093-137729115 TGAGGAGGTTTGAAAGCCCAGGG - Intronic
1203669960 Un_KI270755v1:1000-1022 AAAAGTGGAATGAAAACCAAAGG - Intergenic
1185514096 X:685818-685840 AAAGGAGGAAAGAAAGACAAAGG - Intergenic
1185756945 X:2659789-2659811 AGAGGAGGAATGGGAGGGAAGGG - Intergenic
1185758361 X:2670264-2670286 TGAAGAGAAATGGAAGCCAAAGG - Intergenic
1189159238 X:38793779-38793801 AAAGGAAGAAAGAAAGACAAAGG + Intergenic
1189335113 X:40166461-40166483 ACAGGAGGAAAGAAAGGCATGGG - Intronic
1189357624 X:40323441-40323463 AGAGGAGGAATGGAAGGATAAGG - Intergenic
1189619457 X:42820300-42820322 AAAAGTGGAATGAAAGCCCAAGG - Intergenic
1189908271 X:45783891-45783913 GGAGGAGGAAGGAAAGACATTGG - Intergenic
1190679581 X:52813324-52813346 ACAGGAGGAAAGAAAGCAATAGG + Intronic
1190736941 X:53262006-53262028 AGAGGGGAAATGACTGCCAAAGG + Intronic
1191840783 X:65512440-65512462 ATAGGAGCAATCAAAGCCAGAGG + Intergenic
1191929529 X:66354751-66354773 AGAAGACTAAAGAAAGCCAAAGG + Intergenic
1191942414 X:66495480-66495502 AGATGAGCAATGAAAGCACATGG + Intergenic
1193332124 X:80246386-80246408 AAAAGAGGAATGAAAGAGAATGG - Intergenic
1194043742 X:88974539-88974561 AGGGGAGAAAAGAAAGGCAAAGG - Intergenic
1194080728 X:89461308-89461330 AGAGGAGGAAGGCAAGGCTAAGG - Intergenic
1195202979 X:102567277-102567299 AGAGGAAGAATGCAAGGGAAGGG - Intergenic
1195402065 X:104471716-104471738 AGAGGAGGGATGAAGGACGATGG - Intergenic
1195505455 X:105651162-105651184 AGCCGAAGAATGAAAACCAAGGG + Intronic
1196706159 X:118718952-118718974 AAAGGAGAAATGAAAGAAAAAGG + Intergenic
1198130531 X:133690262-133690284 AGAGGAGGAGTGAAGGGGAAAGG + Intronic
1198741002 X:139842465-139842487 AGAGGTAGAATGCAAGCAAAAGG - Intronic
1199057523 X:143315924-143315946 AGAAGAGGAATATAAGTCAAGGG - Intergenic
1199170739 X:144732046-144732068 AGAGGATGTATGAAAGCAAATGG - Intergenic
1199454524 X:148013387-148013409 AGAGGAACAATGAAATCCAAGGG - Intronic
1199489214 X:148380206-148380228 AGAAGATGAATGAAAGGGAACGG + Intergenic
1199723065 X:150557036-150557058 AAAGAAGGAATAATAGCCAAGGG + Intergenic
1200106356 X:153715434-153715456 TGAGGAGGAATCAAAGTCACAGG + Intronic
1200307808 X:155046172-155046194 AGAAGAGAAGTGAATGCCAATGG - Intronic
1200387271 X:155906319-155906341 AGAGGAGGCATCAAGGGCAAGGG - Intronic
1200433400 Y:3117510-3117532 AGAGGAGGAAGGCAAGGCTAAGG - Intergenic
1201406242 Y:13653045-13653067 AAAAGAGAGATGAAAGCCAACGG - Intergenic
1201458884 Y:14201146-14201168 AAGGGAGGAAAGAAAGGCAAAGG + Intergenic
1201986092 Y:19968000-19968022 AGTGGAGGAATGAAAATAAAGGG + Intergenic