ID: 1069685118

View in Genome Browser
Species Human (GRCh38)
Location 10:70312977-70312999
Sequence GCCAACCTGGGGCACAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 909
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 839}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069685118_1069685131 7 Left 1069685118 10:70312977-70312999 CCTCCTCTGTGCCCCAGGTTGGC 0: 1
1: 0
2: 5
3: 64
4: 839
Right 1069685131 10:70313007-70313029 GGTGGGCTAATGGGCATTGAGGG No data
1069685118_1069685130 6 Left 1069685118 10:70312977-70312999 CCTCCTCTGTGCCCCAGGTTGGC 0: 1
1: 0
2: 5
3: 64
4: 839
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685118_1069685128 -2 Left 1069685118 10:70312977-70312999 CCTCCTCTGTGCCCCAGGTTGGC 0: 1
1: 0
2: 5
3: 64
4: 839
Right 1069685128 10:70312998-70313020 GCCAGCAAGGGTGGGCTAATGGG No data
1069685118_1069685132 8 Left 1069685118 10:70312977-70312999 CCTCCTCTGTGCCCCAGGTTGGC 0: 1
1: 0
2: 5
3: 64
4: 839
Right 1069685132 10:70313008-70313030 GTGGGCTAATGGGCATTGAGGGG No data
1069685118_1069685126 -10 Left 1069685118 10:70312977-70312999 CCTCCTCTGTGCCCCAGGTTGGC 0: 1
1: 0
2: 5
3: 64
4: 839
Right 1069685126 10:70312990-70313012 CCAGGTTGGCCAGCAAGGGTGGG No data
1069685118_1069685127 -3 Left 1069685118 10:70312977-70312999 CCTCCTCTGTGCCCCAGGTTGGC 0: 1
1: 0
2: 5
3: 64
4: 839
Right 1069685127 10:70312997-70313019 GGCCAGCAAGGGTGGGCTAATGG No data
1069685118_1069685133 9 Left 1069685118 10:70312977-70312999 CCTCCTCTGTGCCCCAGGTTGGC 0: 1
1: 0
2: 5
3: 64
4: 839
Right 1069685133 10:70313009-70313031 TGGGCTAATGGGCATTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069685118 Original CRISPR GCCAACCTGGGGCACAGAGG AGG (reversed) Intronic
900535372 1:3174429-3174451 GCCAGCCTGGGTGACAGTGGGGG + Intronic
900639906 1:3683771-3683793 GCCAATCAGAGGCACAGATGTGG - Intronic
900675120 1:3880646-3880668 GACACACTGGAGCACAGAGGAGG - Intronic
900734047 1:4283742-4283764 GGGAACCTGGGTCAGAGAGGTGG - Intergenic
901074167 1:6542486-6542508 TCCAACCTGGGCGACAGAGCAGG - Intronic
901096306 1:6682892-6682914 TCCAGCCTGGGTGACAGAGGGGG + Intronic
901116292 1:6847732-6847754 TCCAGCCTGGGTGACAGAGGGGG - Intronic
901510297 1:9715144-9715166 TCCAACCTGGGCGACAGAGTGGG + Intronic
901770668 1:11528970-11528992 CCCAGCCTGGGGCTCAGGGGAGG - Intronic
902157205 1:14498324-14498346 TTCACCCTGGGGCACAGAGCAGG - Intergenic
902329340 1:15723541-15723563 ACCAACCTGGGCAACACAGGGGG + Intronic
902572235 1:17354210-17354232 TCCAACCTGGGCAACAGAGTGGG + Intronic
902716000 1:18273074-18273096 TCCAGCCTGGGCAACAGAGGGGG - Intronic
902808712 1:18876280-18876302 GGCAGCCTGGGGTCCAGAGGAGG - Intronic
903461574 1:23524585-23524607 GGTAAACTGAGGCACAGAGGTGG - Intronic
903593909 1:24479496-24479518 GCCACTCTGGGGCAGAGAGGAGG - Intergenic
903686625 1:25136608-25136630 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
904119566 1:28188413-28188435 GCCAGCCTGGGTGACAGAGGGGG + Intronic
904214900 1:28911658-28911680 GGAAGCCTGAGGCACAGAGGTGG + Intronic
904227944 1:29040308-29040330 TCCAGCCTGGGCCACAGAGTGGG - Intronic
904811156 1:33164250-33164272 GCCAAGCTGGGGCATAGATCTGG + Intronic
905002451 1:34683650-34683672 GCCAGCATGGGACACAGAGGAGG - Intergenic
905009324 1:34736627-34736649 CCCAGCCTGGGGGAGAGAGGAGG - Intronic
905588015 1:39137098-39137120 TCCAACGTGGGCAACAGAGGGGG - Intronic
905613948 1:39380879-39380901 TCCAACCTGGGCAACAGAGAGGG + Intronic
905737802 1:40342522-40342544 TCCAACCTGGGTGACAGAGTGGG - Intergenic
906085146 1:43126546-43126568 TCCAAACTGGGTGACAGAGGGGG + Intergenic
906155188 1:43609800-43609822 GCCACCCTGTGGCAGAGACGTGG - Intronic
906557113 1:46722605-46722627 GGCAAGCTGAGGCACAGAGTAGG + Intergenic
907050397 1:51326222-51326244 CTCAGCCTGGGGCACTGAGGAGG + Intronic
907129681 1:52084758-52084780 TTCAACCTGGGTGACAGAGGGGG + Intronic
907279834 1:53340140-53340162 CCCAACCTGGGGCCCAGGGAAGG + Intergenic
907515513 1:54991036-54991058 CCCAACCTGGGACACACAGTGGG - Intronic
907573879 1:55508118-55508140 TCCAGCCTGGGCAACAGAGGAGG - Intergenic
907680721 1:56560866-56560888 TCCAGCCTGGGCGACAGAGGAGG - Intronic
907799193 1:57747776-57747798 TCCAGCCTGGGCGACAGAGGAGG + Intronic
908125484 1:61026139-61026161 GCCAGCCTGGGGAACATAGAGGG - Intronic
908232381 1:62118658-62118680 TCCAACCTGGGCAACAGAGTGGG - Intronic
908757842 1:67485402-67485424 GCAAAGCTGGGGCTGAGAGGTGG + Intergenic
908844936 1:68315465-68315487 TCCAACCTGGGTGACAGAGTGGG - Intergenic
908973362 1:69865505-69865527 TCCAGCCTGGGGCACTGAGCGGG - Intronic
909630054 1:77761335-77761357 TCCAGCCTGGGCAACAGAGGAGG + Intergenic
910882755 1:91937259-91937281 TCCAGCCTGGGAGACAGAGGAGG + Intergenic
912144169 1:106771754-106771776 CCCAGCCTGGGCAACAGAGGAGG + Intergenic
912344399 1:108951349-108951371 CCCAACCTGGGTGACAGAGTGGG + Intronic
912385220 1:109268125-109268147 GGCAACCTGGGGGGCAGAGGGGG + Intronic
912414550 1:109499120-109499142 GCCATGATGGGGCTCAGAGGAGG - Intronic
912702295 1:111887472-111887494 GCCCAGCTGGGCCCCAGAGGAGG - Intronic
912706047 1:111913709-111913731 ACCAACCTGGGCAACATAGGGGG + Intronic
912820608 1:112864968-112864990 TCCAACCTGGGCAACAGAGCAGG - Intergenic
913101447 1:115571453-115571475 GCCAGCCTGGGCAACAGAGCAGG + Intergenic
913629108 1:120689854-120689876 GCCAGCCTGGGAAACAGAGCAGG + Intergenic
914049347 1:144118781-144118803 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
914129837 1:144846663-144846685 TCCAGCCTGGGCCACAGAGTGGG - Intergenic
914560995 1:148819956-148819978 GCCAGCCTGGGAAACAGAGCAGG - Intronic
914611839 1:149310260-149310282 GCCAGCCTGGGAAACAGAGCAGG + Intergenic
914859874 1:151377011-151377033 TCCAGCCTGGGCGACAGAGGAGG + Intergenic
914876324 1:151515042-151515064 GCCAGCCTGGGTCACAGAGCAGG - Intronic
915371993 1:155359156-155359178 GCCAACCTGGGCCACAGAACGGG - Intronic
915429714 1:155856968-155856990 GCCAGCCCTGGGCACCGAGGTGG - Intronic
916647994 1:166806846-166806868 TCCAACCTGGGTGACAGAGCAGG + Intergenic
917999187 1:180475415-180475437 TCCAGCCTGGGCCACAGAGTGGG - Intronic
918339931 1:183559826-183559848 TCCAGCCTGGGCAACAGAGGGGG + Intronic
918629538 1:186699514-186699536 GCCAGCCTGGGCGACAGAGCAGG + Intergenic
918676770 1:187296327-187296349 TCCAGCCTGGGCGACAGAGGAGG - Intergenic
919230732 1:194769875-194769897 TCCAACCTGGGCGACAGAGTGGG + Intergenic
919328278 1:196137202-196137224 TCCAGCCTGGGGGACAGAGGGGG - Intergenic
919698534 1:200607168-200607190 TCCAGCCTGGGCCACAGAGCAGG - Intronic
919882804 1:201911937-201911959 GGGAGCCTGGGGCACAGAGCAGG + Intronic
919924064 1:202183233-202183255 ACCACCCTTGGGCTCAGAGGAGG + Intergenic
921722052 1:218483279-218483301 TCCAACCTGGGCAACAGAGCAGG + Intergenic
921843913 1:219859088-219859110 GTCAACCTGGGACACCGAGGTGG - Intronic
922452179 1:225746193-225746215 GCCAAACTGGGGGAGAGTGGGGG - Intergenic
922775070 1:228210825-228210847 CCCACCCTGGGGCTCAGTGGGGG + Intronic
923593126 1:235338267-235338289 GCTTACCTGGGGGACTGAGGTGG + Intronic
923686371 1:236156321-236156343 GCCAGCCTGGGACACAGACCAGG + Intronic
923870405 1:237987082-237987104 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
924954005 1:248910022-248910044 GCCAGCCTAAGGCACAGTGGAGG + Intronic
1063036410 10:2290617-2290639 CCCATCCTGGGCCACACAGGAGG - Intergenic
1063036441 10:2290755-2290777 GCCCACCTGGGCCACACAGGAGG - Intergenic
1063036476 10:2290891-2290913 CCCATCCTGGGCCACACAGGAGG - Intergenic
1063036509 10:2291029-2291051 CCCATCCTGGGCCACACAGGAGG - Intergenic
1063145932 10:3295114-3295136 GCCAGGCTGGAGCACAGCGGTGG - Intergenic
1063183667 10:3631017-3631039 GCCAAGCTGGGAAAGAGAGGTGG + Intergenic
1063188824 10:3674163-3674185 TCCAACCTGGGCGACAGAGTGGG + Intergenic
1063405729 10:5793023-5793045 TCCAACCTGGGTGACAGAGGGGG - Intronic
1063903225 10:10757109-10757131 TCCAGCCTGGGCAACAGAGGGGG + Intergenic
1064226010 10:13485922-13485944 CCCAAACTGGGGTACAGTGGTGG + Intronic
1064284701 10:13982285-13982307 GCCACCCTGGGCAACATAGGAGG + Intronic
1064356527 10:14623792-14623814 TCCAGCCTGGGGGACAGACGGGG + Intronic
1064728729 10:18307429-18307451 TCCAACCTGGGCAACAGAGCAGG + Intronic
1064987900 10:21229388-21229410 TCCAACCTGGGTAACAGAGGGGG + Intergenic
1065858144 10:29847319-29847341 CCCACCCTGGAGCACAGATGGGG - Intergenic
1066111624 10:32202409-32202431 TCCAACCTGGGCGACAGAGTGGG - Intergenic
1066267037 10:33786549-33786571 TCCAGCCTGGGCCACAGAGTGGG - Intergenic
1066354783 10:34672135-34672157 TCCAGCCTGGGTGACAGAGGAGG + Intronic
1066624219 10:37390105-37390127 TCCAGCCTGGGCAACAGAGGAGG - Intergenic
1067079943 10:43207118-43207140 GCCAGCCTGAGGGCCAGAGGTGG + Intronic
1067466337 10:46501914-46501936 GCCATTCTGGGGCACAAAGGAGG - Intergenic
1067620851 10:47882691-47882713 GCCATTCTGGGGCACAAAGGAGG + Intergenic
1067704105 10:48594387-48594409 GCCAACCAGGGGCTCAGTGAGGG + Intronic
1067776471 10:49168057-49168079 ACCCACCAGGAGCACAGAGGTGG + Intronic
1067849219 10:49744315-49744337 GTTACCCTGGGGCCCAGAGGTGG - Intronic
1067947234 10:50697231-50697253 GCCCACCTGGTACACACAGGTGG + Intergenic
1068394142 10:56439388-56439410 CCCAACCTGGGCAACAGAGTGGG + Intergenic
1068720370 10:60238610-60238632 GCACACCTGCAGCACAGAGGAGG - Intronic
1068856205 10:61799635-61799657 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
1069449031 10:68501218-68501240 TCCAACCTGGGCGACAGAGAGGG + Intronic
1069496662 10:68910154-68910176 TCCAACCTGGGCAACAGAGTGGG + Intronic
1069685118 10:70312977-70312999 GCCAACCTGGGGCACAGAGGAGG - Intronic
1070049885 10:72878147-72878169 TCCAACCTGGGCAACAGAGTAGG - Intronic
1070243434 10:74707064-74707086 CCCAACCTGGGTAACAGAGTAGG - Intronic
1070506954 10:77122108-77122130 GGCAGCCTAGGGCACAGTGGTGG + Intronic
1070645574 10:78199922-78199944 GACAAGCTGGGGCAGAGAGAGGG - Intergenic
1070882548 10:79862219-79862241 GCCCACCTGGTACACACAGGTGG + Intergenic
1071649116 10:87378530-87378552 GCCCACCTGGTACACACAGGTGG + Intergenic
1072235253 10:93448089-93448111 GCCAACCTGGGGCACAGTGAGGG - Intronic
1072744825 10:97932719-97932741 GGCAACCCGGGTCACATAGGAGG + Intronic
1073271878 10:102271780-102271802 TCCAGCCTGGGGGACAGAGCAGG - Intronic
1073396280 10:103220748-103220770 TCCAACCTGGGTGACAGAGCAGG + Intergenic
1074135635 10:110624304-110624326 TCCAGCCTGGGCCACAGAGTGGG - Intergenic
1074188231 10:111114981-111115003 GCACACCTGGCGCACAGAGAGGG - Intergenic
1074881808 10:117665439-117665461 GCCAACTATGGGCACAGTGGAGG + Intergenic
1075114152 10:119612077-119612099 TCCAGCCTGGGGAACAGAGTAGG - Intergenic
1075916120 10:126169020-126169042 TCCAGCCTGGGCCACAGAGTGGG + Intronic
1075924120 10:126236498-126236520 CACAGCCTGGGCCACAGAGGTGG + Intronic
1076068645 10:127468616-127468638 GCCAACCTGGGGAACAGCAAGGG + Intergenic
1076203702 10:128578366-128578388 GCCAACATGGGGCAAAGAGATGG - Intergenic
1076361751 10:129894534-129894556 GAGGAGCTGGGGCACAGAGGCGG - Intronic
1076379267 10:130014117-130014139 AACACCCTGGGGCTCAGAGGCGG + Intergenic
1076438325 10:130461786-130461808 GCCCTCCTGGGGCTCAGATGTGG + Intergenic
1077021099 11:417479-417501 GCCAGCCTTGGGCGCAGAGCGGG - Intergenic
1077243177 11:1522230-1522252 TCCAGCCTGGGCCACAGAGCAGG - Intergenic
1077297516 11:1832903-1832925 GCAAAGCGGGGGCACAGGGGAGG + Intronic
1077423398 11:2463348-2463370 GCCGATCTGGGGGATAGAGGGGG - Intronic
1077477655 11:2797948-2797970 GCCAACCCAGGGCACCGCGGTGG + Intronic
1077487899 11:2847450-2847472 GCCAGCCTGGGGAGCAGAGAAGG + Intronic
1077488914 11:2851516-2851538 GCCAAGATGGTGCTCAGAGGAGG - Intergenic
1077546215 11:3171170-3171192 GCCCTCCTGGGGCACAGACGAGG + Intergenic
1077622834 11:3743047-3743069 TCCAACCTGGGTGACAGAGTGGG - Intronic
1077833031 11:5896388-5896410 TCCAACCTGGGCGACAGAGTGGG + Intronic
1078161807 11:8846594-8846616 ACTACTCTGGGGCACAGAGGAGG - Intronic
1078214095 11:9297113-9297135 TCCAACCTGGGCGACAGAGCAGG - Intronic
1078259427 11:9690932-9690954 TCCAACCTTGGTGACAGAGGGGG - Intronic
1078335559 11:10460435-10460457 TCCAACCTGGGTAACAGAGTGGG - Intronic
1079072908 11:17363619-17363641 TCCAACCTGGGAAACAGAGTGGG - Intronic
1079203526 11:18394865-18394887 GCCACGCTGGGGAACCGAGGAGG + Intronic
1079898595 11:26152261-26152283 TCCAGCCTGGGCCACAGAGCAGG + Intergenic
1080529900 11:33164442-33164464 TCCAGCCTGGGCGACAGAGGGGG - Intergenic
1080601932 11:33829192-33829214 GCCGAGCTGGGGCGCCGAGGGGG - Intergenic
1080783723 11:35455001-35455023 ACAAGTCTGGGGCACAGAGGAGG + Intronic
1081554679 11:44147589-44147611 TCCAACCTGGGTGACAGAGCAGG - Intronic
1081599456 11:44483164-44483186 TCCAACCTGGGTGACAGAGCAGG - Intergenic
1081632185 11:44696907-44696929 TCCAACCTGGGTGACAGAGAGGG - Intergenic
1081650320 11:44819228-44819250 CCCAGCCAGGGGCACAGAGCAGG - Intronic
1081660286 11:44884087-44884109 GCAGACCTGGGGCAGAGAGGAGG - Intronic
1081855602 11:46301307-46301329 TCCAACCTGGGCAACAGAGTGGG + Intronic
1083307769 11:61769911-61769933 GCCTTCCTGAGGCCCAGAGGAGG + Intronic
1083388674 11:62332460-62332482 TCCAACCTGGGTGACAGAGTTGG - Intergenic
1083496172 11:63055981-63056003 ACCAACCTGGGCAACATAGGAGG - Intergenic
1083624054 11:64062933-64062955 GCCATGCTGGAGCACGGAGGTGG - Intronic
1083675956 11:64324765-64324787 GCCAGCCTGGGAGACAGAGCAGG + Intergenic
1083815825 11:65132016-65132038 CCCAACCTGGGGCTCAGGAGAGG - Intronic
1083889309 11:65588105-65588127 CCCAGCCTGGGGATCAGAGGAGG + Intronic
1083993198 11:66258827-66258849 GTCAGTCTGGGGCACTGAGGTGG + Intronic
1084303656 11:68267392-68267414 GCCTCCCTGCAGCACAGAGGAGG + Intronic
1084405686 11:68971546-68971568 TCCAGCCTGGGTGACAGAGGTGG - Intergenic
1084835248 11:71797113-71797135 ACCAACCTGGGCCACATAGTGGG + Intronic
1085158596 11:74320235-74320257 TCCAGCCTGGGGGACAGAGGAGG - Intergenic
1085312972 11:75526774-75526796 TCCAGCCTGGGCCACAGAGCGGG - Intergenic
1085445280 11:76597292-76597314 GGGAAACTGAGGCACAGAGGGGG + Intergenic
1085519464 11:77129616-77129638 GCCAACTTTGGGGGCAGAGGTGG + Intronic
1085690244 11:78658458-78658480 GCCATCCTGGGCCTCAGTGGGGG - Exonic
1086185788 11:84013834-84013856 TCCAACCTGGGTGACAGAGTGGG + Intronic
1086350458 11:85938575-85938597 CCCAGCCTGGGTGACAGAGGGGG + Intergenic
1086741348 11:90373322-90373344 TCCAGCCTGGGTGACAGAGGAGG - Intergenic
1087647946 11:100829576-100829598 GCCACCCTAGGGGGCAGAGGAGG - Intronic
1087990905 11:104744512-104744534 TCCAGCCTGGGGAACAGAGCGGG + Intergenic
1088462039 11:110092834-110092856 GCCAACCTCGGCTCCAGAGGCGG + Intergenic
1088487371 11:110353667-110353689 TCCAACCTGGGTGACAGAGTGGG + Intergenic
1088759099 11:112912630-112912652 GCAAACATGGAGCCCAGAGGAGG + Intergenic
1089218256 11:116849088-116849110 TCCCACCTGCTGCACAGAGGTGG - Intronic
1089267631 11:117277298-117277320 CCCAAGCTGGGGTACACAGGCGG - Intronic
1089386946 11:118074714-118074736 TCCAGCCTGGGCAACAGAGGGGG + Intergenic
1089400939 11:118164343-118164365 GCCAGCTGGGGGCAGAGAGGTGG - Exonic
1089616119 11:119695795-119695817 ACCAACCTGGGGAGCAAAGGGGG - Intronic
1089771640 11:120807377-120807399 GACAAACTGAGGCACAGGGGAGG - Intronic
1089991868 11:122868976-122868998 TCCAACCTGGGTGACAGAGAGGG + Intronic
1090887701 11:130893722-130893744 GGAAACCTGGGGGAGAGAGGAGG + Intronic
1090977257 11:131688572-131688594 AGCAACCCGGGGCACAGAGGGGG - Intronic
1091195405 11:133726707-133726729 GCCAAGCTGGGGCACACAATGGG - Intergenic
1091221126 11:133930714-133930736 GCCCACCTGAGGGAAAGAGGCGG - Intronic
1091747209 12:2999998-3000020 GCCCACCTGGGACACAGGAGGGG - Intronic
1092407820 12:8233307-8233329 ACCAACCTGGGCCACATAGTGGG - Intergenic
1092666021 12:10799216-10799238 TCCAATCTGGGTGACAGAGGAGG - Intergenic
1092812498 12:12284975-12284997 TCCAGCCTGGGCGACAGAGGGGG - Intergenic
1093047417 12:14464292-14464314 TCCAGCCTGGGCAACAGAGGAGG + Intronic
1093933211 12:24975016-24975038 TCCAACCTGGGTGACAGAGTGGG - Intergenic
1093935906 12:25000414-25000436 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
1095287142 12:40426550-40426572 GACCATCTGAGGCACAGAGGCGG - Exonic
1095936276 12:47685346-47685368 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1096134630 12:49189071-49189093 GAGAACCTGCGGCACATAGGCGG + Exonic
1096255574 12:50059980-50060002 GTCAGCCTGGCCCACAGAGGAGG + Intronic
1097493276 12:60296723-60296745 GTCAACCTGGGGAACTGTGGTGG - Intergenic
1097649396 12:62277790-62277812 TCCAACCTGAGGCCCACAGGTGG - Intronic
1098034838 12:66291072-66291094 ACCAACCTGGGGCTGTGAGGAGG - Intergenic
1100324285 12:93526312-93526334 GCCAACCTGGGCAACACAGTGGG - Intergenic
1100447516 12:94675272-94675294 TCCAACCTGGGCAACAGAGTGGG - Intergenic
1100525460 12:95415212-95415234 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
1100945792 12:99782526-99782548 TCCAACCTGGGTGACAGAGTGGG + Intronic
1101277311 12:103216871-103216893 TCCAGCCTGGGCCACAGAGCGGG - Intergenic
1101452033 12:104788600-104788622 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
1102208322 12:111105893-111105915 TCCAACCTGGGCAACAGAGAGGG - Intronic
1102225972 12:111228452-111228474 TCCAACCTGGGAGACAGAGCGGG - Intronic
1102456114 12:113071751-113071773 GCCAGCCTGGGCCGGAGAGGCGG + Intronic
1102528183 12:113526925-113526947 AGCAACTTGGGGCGCAGAGGAGG + Intergenic
1103295590 12:119883895-119883917 TCCAACCTGGGCAACAGAGCAGG + Intergenic
1103318664 12:120077370-120077392 GGCCACTTGGGGAACAGAGGAGG - Intronic
1103516922 12:121514143-121514165 TCCAGCCTGGGTGACAGAGGTGG - Intronic
1103596575 12:122027804-122027826 TCCAGCCTGGGCCACAGAGCAGG + Intronic
1104449641 12:128858638-128858660 TCCAGCCTGGGCAACAGAGGGGG + Intronic
1104863943 12:131941692-131941714 GCGCAGCTGGGGCACAGAGAAGG + Exonic
1105893312 13:24697607-24697629 TCCAGCCTGGGGCACAGAGTGGG + Intronic
1105926312 13:25011846-25011868 TCCAACCTGGGCAACAGAGCAGG + Intergenic
1107373474 13:39777253-39777275 GTCATCCTGGAGCACAGAGGGGG + Intronic
1108319526 13:49275114-49275136 TCCAGCCTGGGTGACAGAGGGGG - Intronic
1108706163 13:52990244-52990266 GCCACCCAGAGGCACAGAGAAGG + Intergenic
1111029175 13:82573502-82573524 GCCAAACATGGGCACAGAGATGG - Intergenic
1111210592 13:85073555-85073577 GCCAACCTGGGCTTCAGAGCAGG - Intergenic
1111685748 13:91498938-91498960 TCCAGCCTGGGGAACAGAGATGG + Intronic
1111828560 13:93298463-93298485 TCCAACCTGGGTGACAGAGTGGG - Intronic
1111890924 13:94081869-94081891 TCCAGCCTGGGTGACAGAGGGGG - Intronic
1112297651 13:98202368-98202390 TTCAACATGGGGCACAGAAGTGG + Intronic
1113411706 13:110095745-110095767 TCCAACCTGGGTGACAGAGCTGG + Intergenic
1113889198 13:113727067-113727089 GCCAACCCGGCACACAGTGGCGG - Intronic
1115014430 14:28593183-28593205 GCCAGCCTGGGCGACAGAGCAGG - Intergenic
1115422420 14:33211521-33211543 TCCAACCTGGGTGACAGAGTGGG + Intronic
1116449491 14:45048944-45048966 TCCAACCTGGGTGACAGAGTGGG + Intronic
1116664950 14:47762780-47762802 TCCAACCTGTGGTGCAGAGGGGG + Intergenic
1117996372 14:61482024-61482046 TCCAGCCTGGGAGACAGAGGGGG - Intronic
1118261592 14:64252279-64252301 TCCAGCCTGGGCCACAGAGCGGG + Intronic
1118269683 14:64330892-64330914 TCCAGCCTGGGTGACAGAGGAGG + Intronic
1118376045 14:65178136-65178158 TCCAGCCTGTGGCACAGAGTGGG - Intergenic
1118600251 14:67466962-67466984 TCCAGCCTGGGCGACAGAGGGGG + Intronic
1118737547 14:68712901-68712923 GAGAAACTGGGGCACAGAGCAGG - Intronic
1118888399 14:69886255-69886277 GCCAACTTGGTGCAAAGAAGAGG - Intronic
1118934132 14:70270854-70270876 TCCAGCCTGGGTGACAGAGGGGG - Intergenic
1118972675 14:70650390-70650412 GCCAGCCTGGGCGACAGAGCAGG + Intronic
1118988629 14:70778305-70778327 TCCAACCTGGGTGACAAAGGGGG - Intronic
1119160982 14:72452398-72452420 GCAGAACTGGGGCACACAGGAGG + Intronic
1119279186 14:73389361-73389383 TCCAACCTGGGTGACAGAGCAGG - Intronic
1119383260 14:74241535-74241557 GCCAAACTGAGCCACAGAGTGGG + Intronic
1119403365 14:74379246-74379268 TCCAGCCTGGGCGACAGAGGGGG + Intergenic
1119520234 14:75279479-75279501 GGCAGCCTGGAGCACGGAGGAGG + Intronic
1119543415 14:75455468-75455490 AGCCACCTGGGGCACAGAGCAGG - Intronic
1119776021 14:77249274-77249296 GCAACCCTGGGGGACAAAGGTGG - Exonic
1120846737 14:89132858-89132880 TCCAGCCTGGGCCACAGAGTGGG - Intronic
1121067609 14:90983244-90983266 TCCAGCCTGGGGGACAGAGCAGG + Intronic
1121117375 14:91353175-91353197 GCAAGCCTGGGGCAAGGAGGAGG - Intronic
1121738635 14:96236126-96236148 TTCAACTAGGGGCACAGAGGAGG + Intronic
1121893276 14:97619185-97619207 GCCTACCTGTAGAACAGAGGTGG + Intergenic
1121920611 14:97877569-97877591 TCCAGCCTGGGCAACAGAGGGGG - Intergenic
1121973339 14:98379507-98379529 TCCAACCTGGGCGACAGAGCAGG + Intergenic
1122228128 14:100291520-100291542 GGCAGCCTGAGGCCCAGAGGCGG + Exonic
1122363126 14:101179232-101179254 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
1122403509 14:101481785-101481807 GCCATCCAGGGGCAGAGAGAAGG + Intergenic
1122622660 14:103068655-103068677 GCCCACCTGGGGTACAGAGCAGG - Intergenic
1122692145 14:103536494-103536516 ACTCACCTGGGGCACAGAGGAGG + Exonic
1122719905 14:103716106-103716128 GCCAACCTGGGAGAGAGCGGGGG - Intronic
1122875785 14:104664257-104664279 GCCAGCCTGGGGCTTGGAGGAGG + Intergenic
1122891294 14:104733423-104733445 GGCAACCCTGGGGACAGAGGGGG - Intronic
1123419284 15:20118352-20118374 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
1123432323 15:20229190-20229212 TCCAACCTGGGTGACAGAGCAGG + Intergenic
1123446582 15:20335147-20335169 TCCAGCCTGGGCCACAGAGTGGG - Intergenic
1123528506 15:21124895-21124917 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
1123668634 15:22630308-22630330 TCCAGCCTGGGGAACAGAGCGGG - Intergenic
1123763924 15:23455837-23455859 TCCAGCCTGGGGGACAGAGCGGG + Intergenic
1124015175 15:25867811-25867833 GCCACCCTGGGCAACATAGGGGG - Intergenic
1124459417 15:29875595-29875617 TCCAACCTGGGTGACAGAGCAGG - Intronic
1124524611 15:30436785-30436807 TCCAGCCTGGGGAACAGAGCGGG - Intergenic
1124618585 15:31261021-31261043 TCCAACCTGGGCAACAGAGTGGG - Intergenic
1124774042 15:32570927-32570949 TCCAGCCTGGGGAACAGAGCGGG + Intergenic
1124782731 15:32651407-32651429 GCCACCCTGTGGCAAAGCGGAGG - Intronic
1125055054 15:35349465-35349487 TCCAGCCTGGGTGACAGAGGGGG - Intronic
1125661961 15:41401463-41401485 TCCAACTTGGGGGACAGAGCTGG - Intronic
1125997173 15:44173546-44173568 TCCAGCCTGGGTGACAGAGGGGG - Intronic
1126558918 15:50022273-50022295 GCCAGTCTGGGGAACAAAGGAGG - Intronic
1126812819 15:52425388-52425410 TCCAACCTGGGCCACAGAGCAGG - Intronic
1126982338 15:54258392-54258414 TCCAACCTGGGAGACAGAGTGGG - Intronic
1127080668 15:55375716-55375738 GCCAACCTGGGTGACAGAGCAGG - Intronic
1127081026 15:55380324-55380346 TCCAGCCTGGGCGACAGAGGGGG - Intronic
1127105443 15:55608891-55608913 GCCAGCCTGGGTGACAGAGTGGG - Intergenic
1128017767 15:64362791-64362813 TCCAGCCTGGGCCACAGAGTGGG - Intronic
1128226846 15:66007719-66007741 TCCAGCCTGGGCAACAGAGGTGG + Intronic
1128471346 15:67956404-67956426 CCCCTCCTGGGGCACAGAGTAGG - Intergenic
1128877305 15:71212929-71212951 GGCAGCATGGGACACAGAGGAGG + Intronic
1129005100 15:72366337-72366359 CCCAGCCTGGGCAACAGAGGAGG - Intronic
1129032217 15:72627713-72627735 GCCAACCTGGGGCCCACAGGAGG - Intergenic
1129081599 15:73045827-73045849 TCCAGCCTGGGCCACAGAGCTGG + Intergenic
1129217679 15:74109526-74109548 GCCAACCTGGGGCCCACAGGAGG + Intronic
1129406979 15:75326451-75326473 GCCAACCTGGGGCCCACAAGAGG - Intergenic
1129470183 15:75749321-75749343 GGCAACCTGGGGCCCACAGGAGG - Intergenic
1129663174 15:77564755-77564777 GGCAAACTGAGGCACGGAGGAGG + Intergenic
1129734843 15:77953821-77953843 GCCAACCTGGGGCCCACAGGAGG + Intergenic
1129747092 15:78030330-78030352 TCCAGCCTGGGTGACAGAGGGGG - Intronic
1129840748 15:78742170-78742192 GCCAACCTGGGGCCCACAGGAGG - Intergenic
1129866365 15:78911732-78911754 GCAACCATGGGGGACAGAGGAGG - Intergenic
1129878539 15:78992630-78992652 GACCACCTGGGCCACACAGGAGG + Intronic
1129892789 15:79082615-79082637 GCCAACCTGGACCACAGTGGTGG + Intronic
1130283148 15:82534326-82534348 GCCAGCCTGGGTAACACAGGAGG + Intergenic
1130343767 15:83022629-83022651 GCCAGCCTGGGCAACAGAGCGGG + Intronic
1130512257 15:84599798-84599820 TCCAGCCTGGGCGACAGAGGAGG + Intergenic
1130735488 15:86544169-86544191 GCCAACCTGGGTCAGAGCAGAGG - Intronic
1130962604 15:88673027-88673049 GCCAACCTAGAGTGCAGAGGGGG + Intergenic
1131064823 15:89427555-89427577 GCCAATGTGGAGAACAGAGGTGG - Intergenic
1131214138 15:90522903-90522925 TCCAACCTGGGCGACAGAGCAGG - Intergenic
1131300459 15:91195186-91195208 CCCAGCCTGGGTAACAGAGGGGG - Intronic
1131428919 15:92370375-92370397 TACAATCTGGGGCACAGAGAGGG + Intergenic
1132786749 16:1661289-1661311 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1132824454 16:1896473-1896495 CCCAGCCTGGGGGACAGAGCGGG - Intergenic
1132824466 16:1896513-1896535 CCCAGCCTGGGGGACAGAGCGGG - Intergenic
1133063735 16:3191756-3191778 GCCAGCCAGGGGCAGAGGGGCGG + Intergenic
1133348765 16:5088136-5088158 ACCAACCTGGGCCACATAGTGGG - Intronic
1133944291 16:10335509-10335531 TCCAGCCTGGGCCACAGAGGCGG + Intronic
1134018470 16:10905729-10905751 TCCAGCCTGGGGCACAGGGCAGG + Intronic
1134036792 16:11037224-11037246 GCCCACCAGGAGCACACAGGGGG - Intronic
1134038967 16:11053396-11053418 TCCAACCTGGGTGACAGAGCAGG - Intronic
1134817793 16:17220501-17220523 TCCAGCCTGGGGGACAGAGTGGG - Intronic
1135814098 16:25616270-25616292 GGGAAACTGAGGCACAGAGGGGG + Intergenic
1136109088 16:28053449-28053471 GCCAACTGGGAGGACAGAGGGGG + Intronic
1136134429 16:28246410-28246432 TCCAGCCTGGGCAACAGAGGAGG - Intergenic
1136169382 16:28479073-28479095 GAGAGACTGGGGCACAGAGGTGG - Intronic
1136172239 16:28496160-28496182 GACAACCTCAGGCAAAGAGGAGG + Exonic
1136175486 16:28513501-28513523 TCCAGCCTGGGCGACAGAGGGGG + Intergenic
1136250165 16:28999128-28999150 TCCAGCCTGGGTGACAGAGGGGG - Intergenic
1136254619 16:29029738-29029760 GGCAAACTGAGGCACAGAGAAGG - Intergenic
1136409949 16:30070282-30070304 GCCAGCCTGGAGCCCCGAGGAGG - Exonic
1136466827 16:30450078-30450100 TCCAACCTGGGCGACAGAGTGGG - Intergenic
1136852317 16:33621948-33621970 TCCAACCTGGGCGACAGAGCAGG - Intergenic
1137275939 16:46933510-46933532 GTCAACCTGAGCCACAGAGCAGG + Intergenic
1137690704 16:50425175-50425197 TCCAGCCTGGGTGACAGAGGGGG - Intergenic
1138099158 16:54238002-54238024 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
1138475350 16:57267535-57267557 TCCAGCCTGGGGGACAGAGTGGG + Intronic
1138480935 16:57303080-57303102 TCCAACCTGGGCCACAGGGCTGG - Intergenic
1138871279 16:60890036-60890058 GCAAAACTGGGGAACAGATGTGG + Intergenic
1139364217 16:66423769-66423791 GCCAACCTGGTGCAGGCAGGTGG - Intergenic
1139595081 16:67952756-67952778 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1140086757 16:71803891-71803913 TCCAGCCTGGGCAACAGAGGAGG + Intronic
1140251120 16:73295182-73295204 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
1140626909 16:76804990-76805012 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
1140675612 16:77326467-77326489 GCTAACCTGAGCCAGAGAGGTGG - Intronic
1141124072 16:81387783-81387805 TCCAGCCTGGGCGACAGAGGGGG + Exonic
1141330092 16:83102981-83103003 TCCAACCTGGGTGACAGAGCAGG - Intronic
1141780327 16:86155306-86155328 GCCAGCCTGGGCAACAGAGTGGG + Intergenic
1142146603 16:88495418-88495440 GGCTACCTGGGGCACCGAGGAGG + Intronic
1142298816 16:89244391-89244413 TCCAGCCTGGGCGACAGAGGAGG + Intergenic
1142412703 16:89924380-89924402 GCCAACCTGGGGCTCGGGCGGGG + Intronic
1203113912 16_KI270728v1_random:1470416-1470438 TCCAACCTGGGCGACAGAGCAGG - Intergenic
1203137808 16_KI270728v1_random:1740373-1740395 TCCAGCCTGGGCCACAGAGTGGG - Intergenic
1142549712 17:731546-731568 TCCAGCCTGGGCCACAGAGCAGG - Intergenic
1142638430 17:1271449-1271471 CCCAGCCTGGGGCAGAGAGAAGG + Exonic
1142799094 17:2333575-2333597 GCAAACCTGGCCCACTGAGGAGG - Exonic
1142903862 17:3029584-3029606 GGCTTCCTGGGGCACAGAAGAGG + Intronic
1143117930 17:4591148-4591170 GCCAGGCTGGTGAACAGAGGGGG - Intronic
1143742518 17:8965107-8965129 GCCAGCCTTGGGCCCAGACGCGG - Intronic
1143748084 17:9008347-9008369 TCCAGCCTGGGGGACAGAGTGGG - Intergenic
1143828772 17:9634140-9634162 AAGAATCTGGGGCACAGAGGAGG - Intronic
1145219066 17:21073732-21073754 TCCAGCCTGGGCGACAGAGGGGG - Intergenic
1146102220 17:29994071-29994093 TCCAGCCTGGGGAACAGAGAGGG + Intronic
1146269573 17:31476213-31476235 TCCAGCCTGGGTGACAGAGGAGG - Intronic
1146563069 17:33888461-33888483 GCCAAATTGGGGTACAGAGTGGG - Intronic
1147003805 17:37385440-37385462 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1147157980 17:38554178-38554200 TCCAGCCTGGGGAACAGAGTGGG + Intronic
1147222948 17:38950412-38950434 TCCAGCCTGGGTGACAGAGGAGG - Intronic
1147279744 17:39349219-39349241 TCCAGCCTGGGGAACAGAGCGGG + Intronic
1147629500 17:41920558-41920580 TCCAACCTGGGTGACAGAGAAGG + Intronic
1147703590 17:42411160-42411182 TCCAACCTGGGTGACAGAGTAGG + Intronic
1147741657 17:42673829-42673851 GCCAACCTGGGGGCCGGAGAGGG + Exonic
1147804140 17:43117706-43117728 TCCAACCTGGGCGACAGAGCTGG + Intronic
1147845831 17:43403333-43403355 TCCAGCCTGGGTAACAGAGGAGG - Intergenic
1148207220 17:45786668-45786690 TCCAACCTGGGCGACAGAGTGGG - Intronic
1148538671 17:48462298-48462320 TCCAGCCTGGGCCACAGAGCAGG + Intergenic
1149103969 17:52939638-52939660 TCCAGCCTGGGGAACAGAGTGGG - Intergenic
1149117855 17:53119668-53119690 GCCATAGTGGGGCACAGATGAGG + Intergenic
1149328378 17:55556123-55556145 GCCACCCTGGTCCACACAGGAGG + Intergenic
1149646022 17:58242298-58242320 GGCAGCCTGGGGCACAGCTGTGG + Intronic
1149753173 17:59165365-59165387 TCCAGCCTGGGCAACAGAGGGGG - Intronic
1149786206 17:59437445-59437467 ACCAACCTGGGCAACACAGGGGG - Intergenic
1150070838 17:62148617-62148639 TCCAGCCTGGGGGACAGAGTAGG - Intergenic
1150577953 17:66446593-66446615 GCCCACCTGGTGCTCAGTGGAGG - Intronic
1151308282 17:73277998-73278020 TCCAACCTGGGCAACAGAGCAGG - Intergenic
1151418568 17:73982756-73982778 GGAAACCAGGGTCACAGAGGAGG - Intergenic
1151730172 17:75906352-75906374 GCCAAGGTGGGGCAGTGAGGAGG - Intronic
1151775718 17:76200209-76200231 GCCAGCCTGGGCGACAGAGCGGG + Intronic
1151976729 17:77487678-77487700 GCCTTCCTGGAGCACAGAGTGGG + Intronic
1152219430 17:79054145-79054167 TCCAGCCTGGGGTACAGAGTGGG + Intergenic
1152283210 17:79397460-79397482 TCCAGCCTGGGCAACAGAGGAGG + Intronic
1152404605 17:80089559-80089581 GCCAACCTCTGGCATACAGGGGG - Intronic
1153204477 18:2682355-2682377 TCCAGCCTGGGGCTGAGAGGTGG - Intronic
1153860039 18:9193340-9193362 ACCAGCCTGGGCCACACAGGGGG - Intronic
1153907636 18:9677204-9677226 TCCAGCCTGGGGGACAGAGCAGG - Intergenic
1154358319 18:13639621-13639643 AGCAGCCTGGGGCACAGAGCTGG + Intronic
1154501844 18:15001251-15001273 GCACACCTGGGACACAGAGGGGG - Intergenic
1155215086 18:23636166-23636188 GCCAGCCTGGGCGACAGAGCAGG - Intronic
1156214435 18:34981345-34981367 TCCAGCCTGGGGGACAGAGAGGG + Intronic
1157551213 18:48583023-48583045 GCAGACATGGGGCAGAGAGGTGG - Intronic
1157713156 18:49863806-49863828 GCCACCCTGGGGGACTGAGGAGG + Intronic
1158080374 18:53583290-53583312 TCCAGCCTGGGGGACAGAGCTGG - Intergenic
1159769159 18:72528001-72528023 TCCACCCTGGGTGACAGAGGAGG - Intergenic
1159769307 18:72529244-72529266 TCCAGCCTGGGTGACAGAGGAGG + Intergenic
1159938245 18:74385739-74385761 TCCAGCCTGGGCCACAGAGAGGG - Intergenic
1160506406 18:79429188-79429210 TCCAGCCTGGGCCACAGAGCGGG + Intronic
1160607984 18:80066522-80066544 GCCATCCTTGGACACACAGGAGG + Intronic
1160753953 19:748105-748127 GCCACCCAGGGGCAGAGCGGAGG - Exonic
1160907139 19:1456723-1456745 GCCCACCTGGGGGACAGATGAGG - Intronic
1160915866 19:1496227-1496249 CCCCACCAGGGGCACAGAGCTGG + Intronic
1160921194 19:1521592-1521614 GCCAGCCTGGGGCAGGGCGGGGG + Intergenic
1161229242 19:3164388-3164410 TCCAGCCTGGGCCACAGAGCGGG - Intergenic
1161359846 19:3841772-3841794 TCCAGCCTGGGCCACAGAGCTGG + Intronic
1161507167 19:4650217-4650239 GGGAACCTGCGGCTCAGAGGAGG + Intronic
1161651858 19:5490625-5490647 GCCAGCCTGGAGGTCAGAGGAGG - Intergenic
1162297368 19:9822529-9822551 TCCAGCCTGGGGGACAGAGTCGG - Intronic
1162464458 19:10831682-10831704 GCCACCCTGGGGGACCCAGGAGG - Exonic
1162582790 19:11540698-11540720 TCCAACAGGGGGCACAGAGGGGG + Intronic
1162745830 19:12797686-12797708 TCCAGCCTGGGCAACAGAGGAGG - Intronic
1163029688 19:14536298-14536320 TCCAGCCTGGGCAACAGAGGGGG - Intronic
1163042811 19:14615073-14615095 GGCAAACTGAGGCCCAGAGGTGG + Intergenic
1163275879 19:16283887-16283909 CCCAGCCAGGGGCCCAGAGGCGG - Intergenic
1163288660 19:16364727-16364749 GACAGCCTGGGGCTCACAGGAGG - Intronic
1163436803 19:17300951-17300973 GGCCACCTGGGGCGCAGAGCTGG + Exonic
1163539122 19:17896497-17896519 TCCAGCCTGGGGGACAGAGTGGG - Intergenic
1163584044 19:18154411-18154433 TCCAGCCTGGGGCCCAGAGTAGG - Intronic
1164180245 19:22811999-22812021 TCCAGCCTGGGGGACAGAGAGGG - Intergenic
1164702826 19:30297909-30297931 TCCAGCCTGGGCGACAGAGGGGG - Intronic
1164988940 19:32670641-32670663 TCCAGCCTGGGCAACAGAGGGGG + Intronic
1165028549 19:32980572-32980594 TCCAACCTGGGTGACAGAGCAGG + Intronic
1165032224 19:33006391-33006413 ACCAGCCTGGGCCACACAGGAGG - Intronic
1165064902 19:33223458-33223480 GCCCACCTGGGGCAGAAAGGTGG + Intronic
1165116470 19:33532067-33532089 TCCAGCCTGGGGGACAGAGCAGG - Intergenic
1165172099 19:33900800-33900822 TCCAACCTGGGTGACAGAGGGGG + Intergenic
1165240814 19:34465603-34465625 TCCAGCCTGGGCGACAGAGGGGG + Intronic
1165457424 19:35921243-35921265 TCCAGCCTGGGTGACAGAGGGGG - Intergenic
1165674105 19:37706719-37706741 TCCAACCTGGGTGACAGAGTGGG - Intronic
1166040188 19:40197754-40197776 GCAAACCTGGGGCAGAAGGGAGG - Intronic
1166080530 19:40441540-40441562 AAGAACCTGGGGCACAGAAGAGG + Exonic
1166228643 19:41412732-41412754 TCCAGCCTGGGCGACAGAGGTGG - Intronic
1166502537 19:43352985-43353007 CCCCATCTGGGGTACAGAGGTGG + Intergenic
1166658236 19:44627618-44627640 GCCCCCATGGGGCACAGAGCTGG + Intronic
1166658271 19:44627841-44627863 GGCAAACTGAGGCACAGAGAAGG - Intronic
1166845247 19:45723341-45723363 TCCAGCCTGGGCAACAGAGGTGG + Intronic
1166848886 19:45748106-45748128 TCCAGCCTGGGGTACAGAGCGGG - Intronic
1166926354 19:46271400-46271422 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
1166931478 19:46304072-46304094 GCTCACCTGCGGCGCAGAGGCGG - Exonic
1166988912 19:46678825-46678847 GGGAAACTGAGGCACAGAGGGGG - Intronic
1167010998 19:46807501-46807523 TCCAACCTGGGCGACAGAGCTGG + Intergenic
1167063707 19:47168159-47168181 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1167095817 19:47374626-47374648 GGCAAGCTGAGGCCCAGAGGGGG + Intronic
1167753078 19:51392544-51392566 TCCAGCCTGGGTGACAGAGGGGG - Intergenic
1167782153 19:51605798-51605820 GAGGACCTGGGGAACAGAGGAGG - Intergenic
1167972655 19:53198099-53198121 TCCAGCCTGGGTAACAGAGGGGG - Intergenic
1168034596 19:53709435-53709457 TCCAGCCTGGGCGACAGAGGTGG - Intergenic
1202688795 1_KI270712v1_random:71676-71698 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
925162150 2:1693083-1693105 TCCAACCTGGGGCATTCAGGCGG - Exonic
925287040 2:2722545-2722567 GACAGACTGGGGCACAGAGCAGG + Intergenic
925287055 2:2722625-2722647 GACAGACTGGGGCACAGAGCAGG + Intergenic
925287070 2:2722705-2722727 GACAGACTGGGGCACAGAGAAGG + Intergenic
925480426 2:4264706-4264728 TCCAGCCTGGGGCACAGAGCTGG + Intergenic
925657789 2:6167986-6168008 GCCAAGCAGGAGCACAGAGCTGG - Intergenic
925952005 2:8923542-8923564 GCCAAGCAGAGGGACAGAGGAGG - Intronic
926661749 2:15474589-15474611 TCCAGCCTGGGTGACAGAGGAGG - Intronic
926912352 2:17862947-17862969 GCAAACCTGGGGCACATGGTGGG - Intergenic
926961316 2:18361577-18361599 GGGAACCTGGAGCATAGAGGGGG + Intronic
927088399 2:19692009-19692031 TGCAACCTGGGGCTCAGGGGAGG + Intergenic
927949807 2:27159671-27159693 GGCAGCCTGGAGCACAGAGGTGG - Intergenic
927969333 2:27295094-27295116 TCCAACCTGGGCGACAGAGCAGG - Intronic
928056575 2:28062225-28062247 GCCAGCCTGGGTGACAGAGCAGG + Intronic
928298000 2:30102129-30102151 GCCAAACTGGGGAACCCAGGAGG + Intergenic
928497410 2:31847979-31848001 ACCAACCTGGGTGACAGAGTGGG + Intergenic
928548868 2:32352744-32352766 TCCAGCCTGGGGGACAGAGCAGG - Intergenic
928620084 2:33080055-33080077 TCCAGCCTGGGTGACAGAGGGGG - Intronic
928863015 2:35883067-35883089 TCCAACCTGGGCAACAGAGTAGG - Intergenic
929588624 2:43131332-43131354 GCCAGCCCCGGGCTCAGAGGTGG - Intergenic
929641282 2:43582598-43582620 TCCAGCCTGGGTGACAGAGGGGG - Intronic
929971075 2:46577428-46577450 TCCAACCTGGGCCACAGAGTGGG - Intronic
930052023 2:47223840-47223862 TCCAGCCTGGGCGACAGAGGGGG + Intergenic
930578205 2:53178024-53178046 TCCAACCTGGGCAACAGAGTGGG + Intergenic
930659447 2:54039321-54039343 TCCAGCCTGGGCCACAGAGTGGG - Intronic
930748408 2:54908238-54908260 TCCAACCTGGGTGACAGAGTGGG - Intronic
931056482 2:58478014-58478036 CCCAACCTGGGTGACAGAGTAGG + Intergenic
931231252 2:60376610-60376632 AACAACCTGGGCCAAAGAGGAGG - Intergenic
931575081 2:63710274-63710296 GCCAACCTTGGGCACCCTGGTGG - Intronic
931630437 2:64293738-64293760 GCCAGCCTGGGCAACAGAGCAGG - Intergenic
931655484 2:64507516-64507538 CCCAACCTGGAGGACAGAGTTGG + Intergenic
931953844 2:67396471-67396493 TCCAGCCTGGGCGACAGAGGGGG - Intergenic
932141724 2:69284654-69284676 TCCAGCCTGGGCAACAGAGGAGG - Intergenic
933688393 2:85160818-85160840 TCCAGCCTGGGGGACAGAGCAGG + Intronic
934170385 2:89536417-89536439 TCCAGCCTGGGCAACAGAGGAGG + Intergenic
934280687 2:91610741-91610763 TCCAGCCTGGGCAACAGAGGAGG + Intergenic
935162177 2:100538485-100538507 TCCAACCTGGGCCACAGAGCAGG + Intergenic
936030807 2:109068679-109068701 GCCAACCTGGGGCTCAGACATGG - Intergenic
936105764 2:109623298-109623320 GACATGCAGGGGCACAGAGGAGG - Intergenic
937095415 2:119232281-119232303 GCCAACTCGGGGCCCAGAGGAGG + Intronic
937216282 2:120315607-120315629 GGCAGCCAGGGACACAGAGGAGG - Intergenic
937246482 2:120497284-120497306 GACAACCTGGGGCAGAGCTGAGG - Intergenic
937345187 2:121121077-121121099 GGCCACCTGGGGCAGAGAGCAGG - Intergenic
937428820 2:121821255-121821277 GCCAGCCTGAGGGGCAGAGGTGG - Intergenic
937837983 2:126493129-126493151 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
937938558 2:127266744-127266766 TCCAGCCTGGGGAACAGAGCAGG - Intronic
938052426 2:128186574-128186596 TCCAACCTGGGTGACAGAGTGGG + Intronic
938115734 2:128602021-128602043 GCCAGCCTGGGGCCAAGGGGAGG - Intergenic
938393246 2:130921720-130921742 TCCAGCCTGGGTGACAGAGGGGG - Intronic
938501025 2:131831420-131831442 GCACACCTGGGACACAGAGGGGG - Intergenic
939449055 2:142349021-142349043 GCCAGCCTGGGCAACAGAGTGGG - Intergenic
941475498 2:165946805-165946827 TCCAGCCTGGGCAACAGAGGAGG + Intronic
941850422 2:170174672-170174694 TCCAACCTGGGTGACAGAGCAGG - Intergenic
941908504 2:170740045-170740067 TCCAACCTGGGCAACAGAGCAGG - Intergenic
941931815 2:170948091-170948113 TCCAGCCTGGGCAACAGAGGTGG + Intronic
941988702 2:171533800-171533822 TCCAACCTGGGCAACAGAGCTGG - Intronic
942302345 2:174573918-174573940 TCCAGCCTGGGCAACAGAGGAGG - Intronic
942305896 2:174607370-174607392 TCCAACCTGGGCAACAGAGCAGG + Intronic
942738552 2:179146013-179146035 CCCACCCTGGGCCACAGAGCAGG + Intronic
943260467 2:185653623-185653645 GACAACTTGAAGCACAGAGGGGG + Intergenic
944350835 2:198724846-198724868 TCCAGCCTGGGGGACAGAGCAGG - Intergenic
944770077 2:202905174-202905196 TCCAACCTGGGTGACAGAGCAGG - Intronic
944785398 2:203065059-203065081 GCCAACCTGGGCAACATAGCAGG + Intronic
945300924 2:208215765-208215787 TCCAACCTGGGAGACAGAGCGGG - Intergenic
945493675 2:210484300-210484322 GCCCAGCTGGAGCACAGAGAGGG + Intronic
946109562 2:217402693-217402715 GCCATCCTCAGGCACAAAGGAGG + Intronic
946170865 2:217894624-217894646 TCCAGCCTGGGCGACAGAGGGGG + Intronic
946196643 2:218036095-218036117 GGGAACCTGGGGCACAGAGAGGG - Intronic
946700339 2:222406196-222406218 GTTAACCTGGGGCACAGAGAAGG + Intergenic
947722048 2:232376120-232376142 TCCAGCCTGGGGGACAGAGTGGG + Intergenic
948856776 2:240733961-240733983 GCCAGCCTGGGGCAGGGAGTCGG - Intronic
949012425 2:241688652-241688674 TCCAGCCTGGGGGACAGAGCAGG - Intergenic
1168796013 20:610467-610489 TTCAACCTGGGGGACGGAGGCGG - Intergenic
1168861416 20:1048518-1048540 CCCAACCTGAGGCACAGAATTGG - Intergenic
1169043599 20:2517701-2517723 ACCAGCCTGGGTGACAGAGGGGG - Intronic
1169119101 20:3084670-3084692 GGCATCCTGGTGCACACAGGTGG + Exonic
1169121383 20:3098269-3098291 TCCAACCTGGGTGACAGAGCAGG + Intergenic
1169331841 20:4722460-4722482 GCCACCCTGGGACAAAGACGAGG + Intronic
1169508903 20:6242936-6242958 GCCAAGATGAGGCAGAGAGGAGG + Intergenic
1170598289 20:17821798-17821820 TCCAGCCTGGGCGACAGAGGGGG + Intergenic
1170649253 20:18225013-18225035 GTCAGCCTGGGGCTCCGAGGGGG - Intergenic
1170860776 20:20101654-20101676 TCCAACCTGGGTGACAGAGGGGG - Intronic
1171142387 20:22754602-22754624 TCCAGCCTGGGCCACAGAGCAGG - Intergenic
1171439530 20:25148976-25148998 GACCACCTGGGGAAGAGAGGAGG + Intergenic
1171464276 20:25316894-25316916 TCCAGCCTGGGCAACAGAGGAGG + Intronic
1172081211 20:32342262-32342284 TCCAGCCTGGGCAACAGAGGAGG + Intergenic
1172717296 20:36974402-36974424 TCCAGCCTGGGCCACAGAGCGGG + Intergenic
1172727890 20:37060668-37060690 GCTAACTTGGGGGACTGAGGTGG + Intronic
1172761940 20:37329122-37329144 TCCAGCCTGGGCAACAGAGGGGG - Intergenic
1172826781 20:37795163-37795185 GCCAGCCTGGGCAACAGAGAGGG - Intronic
1173506736 20:43593067-43593089 CCCAGCCTGGGTCACAGAGTGGG + Intronic
1173542528 20:43864894-43864916 TCCAACCTGGGCAACAGAGTAGG + Intergenic
1173728416 20:45312456-45312478 GCTAAACTGGGGCGCGGAGGTGG + Intronic
1173743591 20:45419617-45419639 GCCATCCAGGGGCTCAGAGAAGG + Intronic
1174012931 20:47465241-47465263 TCCAACCTGGGTGACAGAGTGGG - Intergenic
1174380629 20:50153421-50153443 CCCAACCTCGGGCCCAGATGCGG - Intronic
1175130633 20:56786796-56786818 GCCAGCTTGGGGCACAGGGAAGG + Intergenic
1175578511 20:60080571-60080593 ACTCACCTGGGGGACAGAGGAGG - Intergenic
1175906166 20:62380660-62380682 GCCCACCTGGGGCAGAGACTGGG - Intergenic
1177429473 21:20972452-20972474 TCCAACCTGGGAGACAGAGTGGG + Intergenic
1177606649 21:23387371-23387393 TCCAGCCTGGGCCACAGAGCGGG + Intergenic
1178312245 21:31539294-31539316 TCCAGCCTGGGCCACAGAGCGGG - Intronic
1178556152 21:33592171-33592193 TCTAGCCTGGGCCACAGAGGGGG - Intronic
1178938541 21:36885308-36885330 GCCAACCTGGGTAACATAGTGGG + Intronic
1179777283 21:43673601-43673623 TCCAGCCTGGGCCACAGAGTGGG + Intronic
1180280779 22:10692250-10692272 TCCAGCCTGGGCAACAGAGGGGG + Intergenic
1180552628 22:16552925-16552947 TCCAGCCTGGGCCACAGAGTGGG - Intergenic
1180800424 22:18629252-18629274 CCGCACCTGGGGGACAGAGGGGG + Intergenic
1180851658 22:19024808-19024830 CCGCACCTGGGGGACAGAGGGGG + Intergenic
1180896826 22:19341416-19341438 TCCAACCTGGGTGACAGAGTGGG + Intronic
1181221295 22:21366010-21366032 CCGCACCTGGGGGACAGAGGGGG - Intergenic
1181343183 22:22198947-22198969 GCCAGCCTGGAGCCCAGAGATGG - Intergenic
1181351401 22:22261111-22261133 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
1181403607 22:22666783-22666805 GCCCAGCTGGGGCAAAGAGAAGG + Intergenic
1181413883 22:22745898-22745920 GCCCAGCTGGGGCAAAGAGAAGG + Intronic
1181817717 22:25451147-25451169 TCCAACCTGGGCGACAGAGCGGG - Intergenic
1181881573 22:25984591-25984613 ACCAACCTGGGGAACATAGCAGG + Intronic
1182005484 22:26956071-26956093 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
1182544595 22:31067583-31067605 TCCAGCCTGGGCAACAGAGGGGG - Intronic
1182724837 22:32436268-32436290 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1182775939 22:32830964-32830986 CCCAACCAGGGGCACAGGGGTGG + Intronic
1182825080 22:33258057-33258079 TCCAGCCTGGGGGACAGAGCAGG - Intronic
1183099071 22:35572473-35572495 ACCACCTTGGGGCACAGGGGAGG - Intergenic
1183231924 22:36587887-36587909 GCTATGCTGGGGCACAGAGACGG - Intronic
1183378212 22:37477341-37477363 GCTCTCCTGGGCCACAGAGGTGG + Intronic
1183387852 22:37525355-37525377 GGCAAACTGAGGCACAGAGAGGG - Intergenic
1183455883 22:37922964-37922986 TCCAACCTGGGTGACAGAGTGGG - Intronic
1183582183 22:38732583-38732605 GCCTGCCCAGGGCACAGAGGTGG - Exonic
1183796119 22:40119551-40119573 TCCAACCTGGGCAACAGAGCAGG + Intronic
1183891738 22:40935344-40935366 TCCAGCCTGGGCTACAGAGGGGG + Intergenic
1184763199 22:46557258-46557280 GCAATGCTGGGGCACAGATGGGG + Intergenic
1185281643 22:49972310-49972332 GCCAGGCTGGGGCGCAGGGGAGG - Intergenic
1185337040 22:50275341-50275363 CCCAACCTAGGGCATGGAGGCGG + Exonic
1185378848 22:50497121-50497143 GACAAGCTGGGGCAGAGAGCTGG - Intergenic
1203237880 22_KI270732v1_random:23725-23747 TCCAGCCTGGGCAACAGAGGGGG + Intergenic
950065479 3:10108305-10108327 GCCGTCCTGGGTCACAAAGGCGG - Intergenic
950131656 3:10551366-10551388 GCCCACCATGGGCACAGATGGGG + Intronic
950182088 3:10920854-10920876 CCCAACCAGAGGCACAGAGCAGG - Intronic
950520660 3:13495952-13495974 GCCCACCTGGGGCACCTAGCAGG + Intronic
950571758 3:13804573-13804595 TCCAGCCTGGGTCACAGAGTGGG + Intergenic
950585161 3:13887082-13887104 ACCAGCCTGGCGCACAGAGGGGG - Intergenic
950886456 3:16366832-16366854 GCAAGCTTAGGGCACAGAGGAGG - Intronic
951211394 3:19979312-19979334 TCCAACCTGGGTGACAGAGCAGG - Intronic
951576565 3:24120609-24120631 GTTACCCTGGAGCACAGAGGTGG + Exonic
951897911 3:27627854-27627876 TCCAACCTGGGTGACAGAGCAGG + Intergenic
952291980 3:32026166-32026188 CCCAGCTTGGGGCACAGAGTGGG - Intronic
953615193 3:44483863-44483885 TCCAACCTGGGCAACAGAGTGGG - Intergenic
953899659 3:46832901-46832923 GCAAACTTGGGGCAGAGAGGAGG - Intronic
953996733 3:47525516-47525538 TCCAGCCTGGGGGACAGAGCGGG + Intergenic
954730731 3:52659450-52659472 TCCAACCTGGGCAACAGAGTGGG - Intronic
955538454 3:59949687-59949709 GCCAACCTGGGGCTCACATTTGG + Intronic
956177774 3:66489489-66489511 TCCAACCTGGGTGACAGAGTGGG + Intronic
956656195 3:71554320-71554342 TCCAGCCTGGGTGACAGAGGGGG + Intronic
956934766 3:74088104-74088126 GCTATCTTGGGGCACAGATGAGG + Intergenic
958940626 3:100309141-100309163 TCCAACCTGGGCAACAGAGCAGG + Intronic
960074087 3:113464035-113464057 TCCAGCCTGGGGGACAGAGTGGG + Intronic
961396161 3:126592623-126592645 TCCAGCCTGGGTCACAGAGTGGG - Intronic
961535738 3:127569473-127569495 GCCAGCCTGGGTCCCTGAGGGGG - Intergenic
961886738 3:130101794-130101816 ACCAACCTGGGCCACATAGTGGG - Intronic
962254902 3:133863977-133863999 GTCAACCAGAGGCCCAGAGGTGG - Intronic
962532295 3:136294340-136294362 TCCAGCCTGGGCCACAGAGCTGG - Intronic
963038483 3:141051790-141051812 GCCATCCTGCAGCGCAGAGGGGG + Exonic
963721017 3:148862174-148862196 CCCAACCTGGGGCTCTCAGGTGG - Intergenic
964752629 3:160066528-160066550 ACCAAACTGGGCCACACAGGAGG - Intergenic
965004922 3:163008218-163008240 TCCAGCCTGGGTAACAGAGGGGG + Intergenic
965873177 3:173284916-173284938 TCCAGCCTGGGGGACAGAGTGGG + Intergenic
966303637 3:178506738-178506760 GCCAGCCTGGGCCACATAGTAGG + Intronic
966394480 3:179488018-179488040 TCCAACCTGGGCAACAGAGTAGG + Intergenic
966473951 3:180322936-180322958 GCCGGCCTGGGGCACAGCGCAGG + Intergenic
966554115 3:181239697-181239719 GCCAACCCGGGGCACTCATGGGG - Intergenic
966805658 3:183805480-183805502 GGAAACCTGGAGCACAGAGGTGG + Intronic
966868797 3:184276875-184276897 TCCCACCTGGGGAACACAGGGGG - Exonic
966951101 3:184818489-184818511 TCCAGCCTGGGTGACAGAGGGGG + Intronic
967097608 3:186190083-186190105 GGGAAACTGAGGCACAGAGGAGG + Intronic
967192844 3:186999875-186999897 TCCAGCCTGGGCAACAGAGGAGG - Intronic
967708494 3:192679573-192679595 TCCAACCTGGGTGACAGAGCAGG + Intronic
967803525 3:193691188-193691210 GCCAACCTGGGCGACAGAGTAGG + Intronic
968071912 3:195789394-195789416 GCCACCCTGGGGCCCTCAGGAGG - Exonic
968084065 3:195866844-195866866 GCCCTCCTGGGGCACGGAGCGGG + Intronic
968510389 4:993027-993049 GCACCCCTGGGGCACAGAGCGGG + Intronic
968839129 4:2988538-2988560 TCCAGCCTGGGCGACAGAGGAGG + Intronic
969409677 4:7019822-7019844 AGGACCCTGGGGCACAGAGGTGG + Intronic
969409708 4:7019930-7019952 AGGACCCTGGGGCACAGAGGTGG + Intronic
970434041 4:16015657-16015679 TCCATCCTGGGTGACAGAGGGGG + Intronic
972126576 4:35774340-35774362 TCCAGCCTGGGTGACAGAGGAGG - Intergenic
972740150 4:41880689-41880711 GGGAACCTGGGGCACAGGAGAGG + Intergenic
972825930 4:42759011-42759033 GCCAGCCTGGGTGACAGAGAGGG + Intergenic
973248005 4:48031093-48031115 TCCAGCCTGGGCCACAGAGCAGG - Intronic
974053557 4:56963284-56963306 TCCAACCTGGGCAACAGAGCAGG + Intergenic
974297018 4:60013096-60013118 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
974523457 4:63016484-63016506 GCCACCCTTCAGCACAGAGGAGG + Intergenic
976180487 4:82394275-82394297 ACCAACCTGGGCCACAGAGTGGG - Intergenic
976294254 4:83454170-83454192 TCCAACCTGGGCAACAGAGTGGG + Intronic
976639143 4:87319149-87319171 TCCAACCTGGGTGACAGAGTGGG + Intronic
976661696 4:87546399-87546421 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
976716888 4:88132588-88132610 GCCATCCTGGGACCCACAGGTGG - Exonic
976718741 4:88150284-88150306 TCCAACCTGGGCAACAGAGGTGG + Intronic
977121413 4:93106375-93106397 TCCAGCCTGGGCAACAGAGGGGG - Intronic
977293573 4:95189176-95189198 GCCAAACTAGGCCACTGAGGTGG - Intronic
977361777 4:96014554-96014576 GCCATCCTGGGTGACAGAGCAGG + Intergenic
977472893 4:97464445-97464467 TCCAACCTGGGTGACAGAGCTGG - Intronic
978453193 4:108859483-108859505 GATAAACTGGGGCACAGAGAAGG + Intronic
978914027 4:114101813-114101835 TGCCACCTGGGGCCCAGAGGCGG + Intergenic
978992239 4:115098723-115098745 TCCAGCCTGGGTGACAGAGGGGG - Intronic
979265765 4:118701212-118701234 GCCAGCCTGGGCAACAGAGTTGG - Intronic
980051095 4:128041168-128041190 TCCAACCTGGGCAACAGAGCAGG + Intergenic
980557479 4:134428712-134428734 TCCAACCTGGGTGACAGAGCGGG - Intergenic
980929217 4:139169315-139169337 TCCAACCTGGGCTACAGAGCGGG + Intronic
981710451 4:147704227-147704249 TCCAGCCTGGGCCACAGAGTGGG - Intergenic
981951745 4:150418050-150418072 TCCAACCTGGGTGACAGAGTGGG - Intronic
982862608 4:160471787-160471809 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
982892398 4:160872135-160872157 TCCAGCCTGGGTAACAGAGGGGG - Intergenic
983280955 4:165680365-165680387 TCCAACCTGGGTGACAGAGGAGG - Intergenic
984293006 4:177818798-177818820 TCCAACTTGGGCAACAGAGGAGG + Intronic
984616418 4:181903743-181903765 TGCAACCTGGGGCCCTGAGGAGG + Intergenic
985579419 5:689120-689142 GCCTTCCTGGCCCACAGAGGTGG - Intronic
985594265 5:781179-781201 GCCTTCCTGGCCCACAGAGGTGG - Intergenic
986945578 5:13015269-13015291 TCCAGCCTGGGGGACAGAGCAGG - Intergenic
986992956 5:13575285-13575307 CCCAGGCTGGGGTACAGAGGTGG - Intergenic
987131192 5:14861623-14861645 CCCAGCCTGGGGGACAGAGGAGG - Intronic
987718694 5:21607166-21607188 TCCAACCTGGGTGACAGAGTAGG - Intergenic
987891178 5:23880716-23880738 TCCAGCCTGGGGGACAGAGAGGG - Intergenic
987992948 5:25238862-25238884 TCCAACCTGGGCAACAGAGCAGG + Intergenic
988554706 5:32226079-32226101 TCCAGCCTGGGCAACAGAGGAGG - Intergenic
988721921 5:33887780-33887802 GCCAGCCTGGGCAACAGAGCAGG - Intronic
989389487 5:40885564-40885586 TCCAACCTGGGTGACAGAGCAGG + Intergenic
989530104 5:42498109-42498131 GCCAGCCTGAGGCACAGAGAAGG - Intronic
990782943 5:59386612-59386634 TCCAGCCTGGGGCACAAAGCAGG + Intronic
991718835 5:69476935-69476957 TCCAGCCTGGGCCACAGAGCGGG + Intergenic
992101898 5:73416040-73416062 GCTCACCTGGGGCCCACAGGTGG + Intergenic
992339135 5:75804657-75804679 GACAATCTGGAGCCCAGAGGAGG + Intergenic
993215241 5:85014369-85014391 TCCAGCCTGGGCCACAGAGCAGG - Intergenic
993603555 5:89958705-89958727 TCCAGCCTGGGCCACAGAGCGGG + Intergenic
993976401 5:94487920-94487942 TCCAACCTGGGCCACAGAGTGGG + Intronic
994190433 5:96863123-96863145 GCAAACTTAGGGCACAGTGGTGG - Intronic
995723532 5:115162757-115162779 GCCAATCTGGCGCACTGAGGAGG - Intronic
997624817 5:135324481-135324503 GCAGGCCTGGGGCAGAGAGGAGG + Intronic
997794258 5:136792379-136792401 TCCAGCCTGGGTAACAGAGGGGG + Intergenic
997908256 5:137842166-137842188 GAGAAGCTGAGGCACAGAGGGGG - Intergenic
997993302 5:138564428-138564450 CCCAACCTGGGTGACAGAGCAGG - Intronic
998420615 5:141981819-141981841 TCCAGCCTGGGGGACAGAGTGGG + Intronic
999213239 5:149908818-149908840 GCCAGCCTGGGCAACATAGGGGG + Intronic
999551233 5:152689401-152689423 GACAGCCTGGGGCTCAGAGCAGG - Intergenic
1000052298 5:157574388-157574410 GGGAAACTGAGGCACAGAGGAGG - Intronic
1000288909 5:159851604-159851626 GCAAACCTGAGGCCCAGAGAGGG + Intergenic
1000868388 5:166543656-166543678 TCCAACCTGGGCAACAGAGTGGG + Intergenic
1001064400 5:168524474-168524496 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
1001504311 5:172264843-172264865 TCCAGCCTGGGAGACAGAGGGGG + Intronic
1001816231 5:174671467-174671489 TCCAGCCTGGGGGACAGAGTGGG + Intergenic
1002031831 5:176435464-176435486 TCCAACCTGGGCAACAGAGTGGG - Intergenic
1002222039 5:177690863-177690885 GCTGACCAGGGGCATAGAGGTGG + Intergenic
1002579681 5:180200338-180200360 TCCAACCTGGGCGACAGAGCAGG - Intronic
1002609244 5:180403595-180403617 GGCATCCTGGGGGACAGAGCGGG - Intergenic
1002756509 6:165583-165605 GCCAGCCTAAGGCACAGTGGAGG - Intergenic
1002913082 6:1506001-1506023 GTCAGCCCGGGGCACAGCGGTGG - Intergenic
1003087159 6:3069047-3069069 CCCGACCTCTGGCACAGAGGCGG - Intronic
1003310892 6:4969005-4969027 TCCAACCTGGGCAACAGAGCAGG + Intergenic
1003524453 6:6886275-6886297 GCCAGCCTGGAGCATGGAGGGGG - Intergenic
1003578489 6:7318418-7318440 TCCAACCTGGGTGACAGAGCAGG - Intronic
1003894544 6:10594874-10594896 TCCAGCCTGGGGAACAGAGCAGG - Intronic
1004633402 6:17443219-17443241 TCCAGCCTGGGTGACAGAGGAGG + Intronic
1004984576 6:21066820-21066842 ACCAACCTGGGCCACATAGTAGG - Intronic
1006390359 6:33754686-33754708 GCCTTCCTGGGGCAGAGATGGGG - Intergenic
1006406366 6:33848035-33848057 GACAACCTGAGGCCCAGAGAGGG - Intergenic
1007404972 6:41629976-41629998 TCCACCCTGGGGAACTGAGGAGG + Intergenic
1007584426 6:42980113-42980135 TCCAACCTGGGTGACAGAGTAGG - Intergenic
1007801530 6:44397991-44398013 GCCAACCTGGGGGCCACAAGGGG - Intronic
1007900542 6:45407520-45407542 TCCAGCCTGGTGGACAGAGGGGG - Intronic
1010088017 6:71944377-71944399 TCCTACCTGGGGCACAGTGTTGG + Intronic
1010199509 6:73270438-73270460 TCCAACCTGGGCAACAGAGCGGG + Intronic
1010722886 6:79303854-79303876 GCCAGCCTGGGCGACAGAGCAGG - Intergenic
1012281516 6:97332886-97332908 CCCAAGCTGGAGCACAGCGGTGG - Intergenic
1012436968 6:99225156-99225178 TCCAGCCTGGGCAACAGAGGGGG + Intergenic
1013304447 6:108835357-108835379 GCCTACATGGGGCACCGTGGTGG + Intergenic
1013888863 6:115001747-115001769 GCTGAACTGGGGCACAGAAGGGG - Intergenic
1015405722 6:132835092-132835114 TCCAACCTGGGCGACAGAGCAGG - Intergenic
1015645504 6:135383431-135383453 ACCAACCTGGGCCACACAGTGGG - Intronic
1015682583 6:135824731-135824753 GCCATCCTGGGGCACAGTGCAGG + Intergenic
1016334350 6:142988575-142988597 TCCAGCCTGGGCAACAGAGGGGG - Intergenic
1016667169 6:146655424-146655446 CCCAACATGGGGCAGGGAGGTGG - Intronic
1016698429 6:147025773-147025795 CACAACCTGGGGCAGAGATGAGG - Intergenic
1016704198 6:147088109-147088131 GACAATCTGGGGCTCAAAGGTGG + Intergenic
1016830127 6:148425760-148425782 TCCAGCCTGGGGGACACAGGGGG - Intronic
1017652634 6:156597353-156597375 GGCAAGCTGGGGGACAGGGGAGG - Intergenic
1017863453 6:158421329-158421351 TCCAGCCTGGGCCACAGAGCGGG + Intronic
1017897486 6:158693258-158693280 CCTAACCTGGAGCACAGTGGCGG + Intronic
1018164340 6:161079181-161079203 TCCAACCTGGGAAACAGAGCAGG + Intronic
1019117165 6:169774524-169774546 GCCACCATGGGGCACAGCAGAGG - Intronic
1019137489 6:169919849-169919871 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
1019339062 7:499747-499769 TCCAGCCTGGAGCACAGATGTGG + Intronic
1019579336 7:1752291-1752313 GCCACCATGGGGCAGTGAGGGGG + Intergenic
1019722581 7:2582276-2582298 GCACACCTGGGGGACAGAGCAGG - Intronic
1019743079 7:2684764-2684786 CCCAACTTGGGGCACCCAGGAGG + Intronic
1020111882 7:5452132-5452154 GCCACCCTGGGGCAGGCAGGAGG - Intronic
1020712055 7:11619437-11619459 TCCAGCCTGGGGAACAGAGCAGG - Intronic
1020866202 7:13566216-13566238 TCCAGCCTGGGCAACAGAGGTGG + Intergenic
1021510011 7:21425346-21425368 TCCAACCTGGGCAACAGAGTGGG - Intergenic
1021569321 7:22048448-22048470 GCCAATGTGGGGCTAAGAGGAGG + Intergenic
1022665462 7:32406298-32406320 ACCAACCTGGAGCCCTGAGGAGG - Intergenic
1022978892 7:35584441-35584463 ACCAGCCTGGGCCACAGAGTGGG + Intergenic
1023275140 7:38510729-38510751 TACAGCCTGGGGCACAGAGGTGG - Intronic
1023861113 7:44218174-44218196 GCCAGCCTAGGGCACATGGGAGG - Exonic
1024206721 7:47169118-47169140 GCAGACGTGGGGCACAAAGGAGG - Intergenic
1024989834 7:55224435-55224457 CCCCACCTGGGGTGCAGAGGTGG - Intronic
1025221827 7:57117198-57117220 ACCAATTTGGGGCACTGAGGCGG + Intergenic
1025632606 7:63288867-63288889 ACCAATTTGGGGCACTGAGGTGG + Intergenic
1025741953 7:64204807-64204829 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1025753253 7:64311694-64311716 TCCAGCCTGGGTGACAGAGGAGG - Intronic
1026006277 7:66602659-66602681 GCCAAGCTGGGTGACAGAGCAGG - Intergenic
1026044359 7:66895725-66895747 TCCAACCTGGGTGACAGAGCGGG + Intergenic
1026047009 7:66912930-66912952 TCCAACCTGGGTGACAGAGCCGG - Intergenic
1026121806 7:67544390-67544412 GCCAGCCTGGGTGACAGAGCGGG - Intergenic
1026335096 7:69387377-69387399 TCCAACCTGGGTGACAGAGCAGG + Intergenic
1027008997 7:74725488-74725510 ACCAACCTGGGCAACATAGGGGG + Intronic
1027217777 7:76195125-76195147 TCCAGCCTGGGAGACAGAGGGGG - Intergenic
1027987316 7:85309745-85309767 TCCAGCCTGGGCGACAGAGGGGG - Intergenic
1028011793 7:85654679-85654701 TCCAACCTGGGCAACAGAGCAGG - Intergenic
1028038369 7:86015450-86015472 GCCAACCACAGGCTCAGAGGGGG - Intergenic
1028226676 7:88259742-88259764 GCCAACTTCTGGCACAGAGATGG + Intergenic
1028422862 7:90652980-90653002 GCCAACCCAGGGTACAGAGCAGG - Intronic
1029088044 7:98026625-98026647 GTCCACCTGGGGGGCAGAGGAGG - Intergenic
1029185895 7:98738186-98738208 TCCAGCCTGGGCCACAGAGCGGG + Intergenic
1029200471 7:98835886-98835908 GCCAAGCTGGGGCTCAGACCTGG + Intergenic
1029218235 7:98968047-98968069 TCCAACCTGGGCAACAGAGCAGG - Intronic
1029268781 7:99363704-99363726 TCCAACCTGGGTGACAGAGAAGG - Intronic
1029368134 7:100129383-100129405 GACAACCTCTGGCACAGAGTAGG + Intergenic
1029590602 7:101504409-101504431 GTCAGCATGGGGCAAAGAGGTGG - Intronic
1029712596 7:102307799-102307821 TCCAACCTGGGTGACAGAGTGGG - Intronic
1032073939 7:128827467-128827489 GCCAGGCAGGGGCACACAGGGGG - Intergenic
1032276181 7:130457562-130457584 TCCAACCTGGGTAACAGAGCAGG - Intergenic
1032361743 7:131262579-131262601 TCCAGCCTGGGCCACAGAGCGGG - Intronic
1032889711 7:136181490-136181512 TCCAGCCTGGGGCACAGAGTGGG - Intergenic
1034178725 7:149121420-149121442 TCCAGCCTGGGCCACAGAGCGGG - Intronic
1034432656 7:151048891-151048913 GCCCACCTCAGGCCCAGAGGAGG + Exonic
1034940193 7:155225655-155225677 GCCATCCAGAAGCACAGAGGAGG + Intergenic
1035380646 7:158438331-158438353 TCCAACCTGGGCAACAGAGTGGG + Intronic
1036110655 8:5897592-5897614 TCCAGGCTGCGGCACAGAGGAGG + Intergenic
1036635368 8:10546875-10546897 GCCAGCCTGGGAAACATAGGGGG - Intronic
1036702153 8:11019909-11019931 GCCAGAGTGGGGCAGAGAGGCGG + Intronic
1036913338 8:12779221-12779243 TCCAACCTGGGCAACAGAGCAGG - Intergenic
1037260406 8:17001699-17001721 GCCGAGCTGGGGCGCAGATGGGG + Intronic
1039562630 8:38525532-38525554 GCCAGCCTGGGCGACAGAGCGGG - Intronic
1041090409 8:54296713-54296735 GCCAACAAGGGGCAGAGAGAGGG + Intergenic
1041367091 8:57118225-57118247 TCCAACCTGGGTGACAGAGTGGG - Intergenic
1041541507 8:58990169-58990191 GCAAAACTGAGGCACAGAGCAGG + Intronic
1041554281 8:59135261-59135283 GAGAACTTGGGGCACAGAAGTGG + Intergenic
1041576326 8:59399851-59399873 TCCAACCTGGGTGACAGAGTAGG + Intergenic
1042383947 8:68151384-68151406 ACCAACCTGGGCAACAGAGTGGG + Intronic
1043809355 8:84717154-84717176 TCCAACCTGGGCGACAGAGCGGG + Intronic
1044689427 8:94861969-94861991 TCCAGCCTGGGCGACAGAGGGGG - Intronic
1044987690 8:97769612-97769634 TCCAGCCTGGGGAACAGAGCGGG - Intergenic
1046660595 8:116944400-116944422 TCCAGCCTGGGTGACAGAGGGGG + Exonic
1046799410 8:118408927-118408949 TCCAACCTGGGCGACAGAGTGGG - Intronic
1046829627 8:118730310-118730332 TACAACATGGGGCACAGTGGAGG - Intergenic
1046917112 8:119689501-119689523 TCCAGCCTGGGTCACAGAGTAGG + Intergenic
1046938693 8:119910481-119910503 TCCAGCCTGGGGGACAGAGCGGG - Intronic
1047057464 8:121182204-121182226 TCCAGCCTGGGGTACAGTGGGGG - Intergenic
1047276069 8:123406347-123406369 TCCAGCCTGGGGGACAGAGCGGG + Intronic
1047675938 8:127201702-127201724 GCCAAACTGGGGACCAGAAGGGG - Intergenic
1047769977 8:128022895-128022917 TCCAGCCTGGGCCACAGAGCGGG - Intergenic
1048064043 8:130949713-130949735 GAAAACCTGGGGCAAGGAGGTGG - Intronic
1048856974 8:138694292-138694314 GACATCCAGGGGTACAGAGGTGG + Intronic
1048914864 8:139172865-139172887 TCCAGCCTGGGTGACAGAGGCGG - Intergenic
1049184997 8:141245628-141245650 CCCAACCTGCCGCTCAGAGGAGG + Intronic
1049226028 8:141450911-141450933 GCCAGCTTGGGGCAGAGAAGGGG - Intergenic
1049355849 8:142187655-142187677 GGCCACCTGGGGAACAGAGCTGG + Intergenic
1049591579 8:143465258-143465280 CCCAGCCTGGGGCAGAGGGGTGG - Intronic
1049761232 8:144332820-144332842 GCGATCCAGGGGCGCAGAGGCGG + Exonic
1049845397 8:144798599-144798621 GCCACCCGGGGGCAGAGAGTGGG + Intergenic
1051302245 9:15664359-15664381 GGCTACTTGGGGGACAGAGGCGG - Intronic
1051636231 9:19183201-19183223 TCCAGCCTGGGCCACAGAGAGGG + Intergenic
1051641469 9:19228670-19228692 TCCAGCCTGGGTGACAGAGGGGG + Intergenic
1052018489 9:23498139-23498161 GCCAGCCAGGGTCACACAGGGGG + Intergenic
1052324320 9:27200868-27200890 AGGAACCTGAGGCACAGAGGAGG + Intronic
1053141151 9:35683442-35683464 GCCAATTTGGGGTACAGAGAAGG - Intronic
1053223869 9:36334651-36334673 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
1054771355 9:69087266-69087288 TCCAGCCTGGGGGACAGAGTGGG - Intronic
1054907111 9:70421042-70421064 GCAAACCTGGGGCACAGCTCGGG - Intergenic
1055214741 9:73845435-73845457 TCCAGCCTGGGCCACAGAGCAGG + Intergenic
1055930596 9:81555980-81556002 GCCAACCTGGGAGATGGAGGAGG - Intergenic
1056030860 9:82551924-82551946 CCCAGCATGGGGCAAAGAGGTGG - Intergenic
1056348869 9:85727294-85727316 TCCAGCCTGGGCAACAGAGGGGG + Intronic
1057196929 9:93120683-93120705 GCCTTCCAGGGGCACAGGGGAGG - Intergenic
1057198067 9:93126164-93126186 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1057501520 9:95600584-95600606 CCCAACCTGGGCGACAGAGCGGG - Intergenic
1057709123 9:97421102-97421124 TCCAGCCTGGGCCACAGAGCTGG + Intronic
1058053896 9:100430880-100430902 CCCATAGTGGGGCACAGAGGTGG + Intronic
1058161581 9:101575705-101575727 GTAAATATGGGGCACAGAGGAGG + Intronic
1058706565 9:107642323-107642345 GCCAAGTTGGGGCACAGAGTGGG + Intergenic
1059129311 9:111729144-111729166 TCCAGCCTGGGCTACAGAGGAGG - Intronic
1059178119 9:112186409-112186431 TCCAGCCTGGGCCACAGAGTGGG + Intergenic
1059283901 9:113156664-113156686 GCTTACCTGGGGACCAGAGGGGG + Intronic
1059484737 9:114617905-114617927 TCCAACCTGGGCAACAGAGTGGG - Intronic
1060347520 9:122829591-122829613 GCCAGCCTGGGTGACAGAGCAGG + Intergenic
1060495917 9:124118517-124118539 GCCTCCTTGGGGCACAGAGCAGG - Intergenic
1060656627 9:125376591-125376613 GCCAGCCTGCTGCAAAGAGGAGG - Intergenic
1061173072 9:128973411-128973433 TCCAGCCTGGGGGACAGAGCAGG - Intronic
1061426540 9:130501945-130501967 GTGGACCTGGGGCACAGAGCAGG + Intergenic
1061483065 9:130906639-130906661 GCCGAGCTGGGGCCCAGAGAGGG - Intronic
1061545301 9:131300997-131301019 TCCAACCTGGGTGACAGAGCGGG - Intronic
1061756655 9:132817662-132817684 GCCAAACTGCAGCAAAGAGGGGG + Intronic
1062028725 9:134352428-134352450 GCCCACCTGGGGCCTAGAGCAGG - Intronic
1062290417 9:135791911-135791933 GCCCACCTGGTGCTCAGGGGGGG - Intronic
1062389045 9:136326915-136326937 GCCACCCAGGGTCTCAGAGGTGG + Intergenic
1062498644 9:136843099-136843121 GCACACCTGGGACACAGAGGGGG + Intronic
1062604579 9:137340638-137340660 GGCCACCTGGGGGACCGAGGTGG - Intronic
1185532816 X:835246-835268 TCCAGCCTGGGCCACAGAGTGGG - Intergenic
1185614140 X:1410373-1410395 TCCAGCCTGGGTGACAGAGGGGG + Intronic
1185628178 X:1497189-1497211 TCCAGCCTGGGGGACAGAGTGGG + Intronic
1185628748 X:1500980-1501002 GCCACCCTGGGCCAGACAGGCGG - Intronic
1185702757 X:2243515-2243537 TCCAGCCTGGGCGACAGAGGGGG - Intronic
1185879656 X:3729735-3729757 TCCAGCCTGGGCAACAGAGGGGG + Intergenic
1186282562 X:8009207-8009229 TCCAGCCTGGGTCACAGAGCAGG - Intergenic
1186474505 X:9846800-9846822 GCCAAGCATGGGCTCAGAGGCGG - Intronic
1187049734 X:15683823-15683845 TCCAACCTGGGTGACAGAGCAGG + Intergenic
1187542292 X:20208685-20208707 TCCAGCCTGGGTGACAGAGGAGG + Intronic
1187886393 X:23892735-23892757 TCCAACCTGGGCGACAGAGCGGG + Intronic
1187915636 X:24150069-24150091 GCCGACCTGGGGCACCGCGCCGG + Intronic
1188684385 X:33051676-33051698 TCCAGCCTGGGGAACAGAGCCGG - Intronic
1188892207 X:35625380-35625402 TCCAGCCTGGGCCACAGAGGGGG + Intergenic
1189336143 X:40172003-40172025 GCCAACCCCAGGCCCAGAGGGGG - Intronic
1189704546 X:43747026-43747048 GCCTAACTGGGCCACAGATGTGG + Intergenic
1189733702 X:44048383-44048405 GTCAACCCAGGGCACAGAGAAGG - Intergenic
1189875417 X:45431606-45431628 TCCAACCTGGGTGACAGAGCAGG - Intergenic
1190777728 X:53566646-53566668 GCCAACCTGGGCAACATAGTGGG - Intronic
1195183521 X:102377042-102377064 GCCAACATGAGACTCAGAGGTGG - Intronic
1195238324 X:102924823-102924845 TCCAGCCTGGGGAACAGAGCTGG + Intergenic
1196210607 X:112991714-112991736 GCCAGCCTGGGTGACAGAGCAGG + Intergenic
1196706325 X:118720708-118720730 TCCAACCTGGGCGACAGAGCAGG - Intergenic
1196873829 X:120138555-120138577 TCCAGCCTGGGGGACAGAGTGGG + Intergenic
1196932218 X:120693530-120693552 TCCAGCCTGGGGGACAGAGCAGG + Intergenic
1197359503 X:125482697-125482719 TCCAGCCTGGGGGACAGAGCGGG - Intergenic
1197702544 X:129610157-129610179 GCCACCCTGGGTCACAAAGTAGG - Intergenic
1198200094 X:134407878-134407900 GCCAACCAGGAGCACAGAGCAGG + Intronic
1199117125 X:144006600-144006622 TCCAGCCTGGGCAACAGAGGAGG - Intergenic
1199199969 X:145075701-145075723 CAGAACCTGGGGCACAGAGTTGG + Intergenic
1199353376 X:146831730-146831752 GCCAAACTTGGGCACAAAGAAGG + Intergenic
1200245784 X:154524317-154524339 TCCAACCTGGGCTACAGAGTTGG + Intergenic
1200708359 Y:6462308-6462330 GCAACCCTGGGGAACACAGGTGG + Intergenic
1200921939 Y:8620987-8621009 GCAAACCCAGGGAACAGAGGTGG - Intergenic
1200922417 Y:8625023-8625045 GCAAACCTGGGTAACACAGGTGG - Intergenic
1200930887 Y:8696075-8696097 GCCACCCTAGGGAACACAGGCGG + Intergenic
1201025753 Y:9702400-9702422 GCAACCCTGGGGAACACAGGTGG - Intergenic
1202177506 Y:22111413-22111435 GCAAGCCTGGGGAACACAGGCGG + Intergenic
1202180093 Y:22132456-22132478 GCCACCCTGGTGAACACAGGGGG + Intergenic
1202211267 Y:22453943-22453965 GCCACCCTGGTGAACACAGGGGG - Intergenic
1202213855 Y:22474971-22474993 GCAAGCCTGGGGAACACAGGCGG - Intergenic