ID: 1069685119

View in Genome Browser
Species Human (GRCh38)
Location 10:70312980-70313002
Sequence CTGGCCAACCTGGGGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 484}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069685119_1069685130 3 Left 1069685119 10:70312980-70313002 CCTCTGTGCCCCAGGTTGGCCAG 0: 1
1: 0
2: 3
3: 41
4: 484
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685119_1069685133 6 Left 1069685119 10:70312980-70313002 CCTCTGTGCCCCAGGTTGGCCAG 0: 1
1: 0
2: 3
3: 41
4: 484
Right 1069685133 10:70313009-70313031 TGGGCTAATGGGCATTGAGGGGG No data
1069685119_1069685131 4 Left 1069685119 10:70312980-70313002 CCTCTGTGCCCCAGGTTGGCCAG 0: 1
1: 0
2: 3
3: 41
4: 484
Right 1069685131 10:70313007-70313029 GGTGGGCTAATGGGCATTGAGGG No data
1069685119_1069685128 -5 Left 1069685119 10:70312980-70313002 CCTCTGTGCCCCAGGTTGGCCAG 0: 1
1: 0
2: 3
3: 41
4: 484
Right 1069685128 10:70312998-70313020 GCCAGCAAGGGTGGGCTAATGGG No data
1069685119_1069685127 -6 Left 1069685119 10:70312980-70313002 CCTCTGTGCCCCAGGTTGGCCAG 0: 1
1: 0
2: 3
3: 41
4: 484
Right 1069685127 10:70312997-70313019 GGCCAGCAAGGGTGGGCTAATGG No data
1069685119_1069685132 5 Left 1069685119 10:70312980-70313002 CCTCTGTGCCCCAGGTTGGCCAG 0: 1
1: 0
2: 3
3: 41
4: 484
Right 1069685132 10:70313008-70313030 GTGGGCTAATGGGCATTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069685119 Original CRISPR CTGGCCAACCTGGGGCACAG AGG (reversed) Intronic
900157885 1:1210856-1210878 TTGGGCAACCCGGGGCTCAGGGG + Intergenic
900238282 1:1602912-1602934 TGGGCCAACCTGGGGAGCAGAGG - Intergenic
900280793 1:1866918-1866940 CACTCCAACCTGGGGCACACAGG + Intronic
900484311 1:2914253-2914275 CTGCCCCATCTGGTGCACAGTGG - Intergenic
900535369 1:3174426-3174448 CTGGCCAGCCTGGGTGACAGTGG + Intronic
901121596 1:6898858-6898880 CTGGCCAACATGGGGCCCCCTGG + Intronic
901584204 1:10273974-10273996 CTGCCCAGGCTGGGGTACAGTGG + Intronic
901702792 1:11054420-11054442 GTGGATAGCCTGGGGCACAGAGG - Intergenic
901735871 1:11311821-11311843 CTGGCCACGCTGGGACACAGTGG - Intergenic
902349798 1:15846261-15846283 TTAGCCAAGCTGGGGCACAATGG - Intergenic
902707352 1:18214781-18214803 CTGGCCAGGCTGGAGTACAGTGG + Intronic
903014113 1:20350776-20350798 CTGACCAACTGGGGGAACAGAGG - Intronic
903809407 1:26026776-26026798 CTGACCACCCTTGGGCACTGAGG + Intronic
904195478 1:28782178-28782200 GTGGCCAGCCTGGAGCAAAGGGG - Intergenic
905440432 1:37993147-37993169 CTTGCCAAGCTGGAGTACAGTGG + Intergenic
905447776 1:38038441-38038463 CACTCCAACCTGGGCCACAGAGG + Intergenic
905576811 1:39051398-39051420 CTGTCCAGGCTGGAGCACAGTGG + Intergenic
906162297 1:43659251-43659273 CTGCCCAGCCTGGAGCACAGTGG - Intronic
906215070 1:44033886-44033908 ATGGCCAGCCTGGGCCACTGTGG + Intergenic
906302803 1:44695903-44695925 TTGCCCAGGCTGGGGCACAGTGG - Intronic
906484284 1:46222283-46222305 GCTGCCAACCTGGGGCTCAGAGG + Intergenic
907174189 1:52502650-52502672 CACGCCAACCTGGGTGACAGAGG - Intronic
907844288 1:58189835-58189857 CTGACCATCCTGAGGCACAGGGG + Intronic
910237243 1:85048387-85048409 CGGGCTCACCTGGGGGACAGCGG + Exonic
910654403 1:89605368-89605390 CTGGCCCACCAGGAGCACATGGG + Intergenic
910662233 1:89686218-89686240 CTGTCCCACCTGGAGCACAAAGG + Intronic
910874115 1:91861893-91861915 GTCGCCAAGCTGGAGCACAGTGG + Intronic
912565682 1:110585609-110585631 CTGGCCAAGCTGAGGCCCAGGGG + Intergenic
912702296 1:111887475-111887497 CTGGCCCAGCTGGGCCCCAGAGG - Intronic
913006129 1:114633398-114633420 TTGCCCAAGCTGGAGCACAGTGG - Intronic
915914016 1:159930569-159930591 CTGGCCAGCTTGGGGTCCAGAGG - Intronic
916669194 1:166997120-166997142 CTGGCCCCCCTGGGCCACATTGG + Intronic
917364094 1:174209645-174209667 TTGACCCACCTGGGGCCCAGGGG + Intronic
917818106 1:178731314-178731336 CTCTCCAGCCTGGGGGACAGAGG - Intronic
919099223 1:193073611-193073633 TTGGCCAGGCTGGAGCACAGTGG + Intronic
920129354 1:203719679-203719701 CTGTCCAGCCTGGGCAACAGAGG + Intronic
920819551 1:209367634-209367656 ATTGCAAACCTGGGGCACTGCGG + Intergenic
921056274 1:211544937-211544959 TTGCCCAGGCTGGGGCACAGTGG + Intergenic
921144699 1:212342985-212343007 CTGCCCAGACTGGAGCACAGTGG + Intronic
921284491 1:213596912-213596934 ATGGCCACCCTGGCTCACAGAGG - Intergenic
921362221 1:214340819-214340841 CTGGTGAAACTGGGGCAGAGGGG - Intergenic
922681593 1:227602965-227602987 TTGCCCAGGCTGGGGCACAGTGG - Intronic
922695122 1:227727445-227727467 TTGCCCAGGCTGGGGCACAGTGG - Intergenic
922880082 1:228974258-228974280 CTGACAAAACTGAGGCACAGAGG - Intergenic
923776176 1:236980436-236980458 CTGCCCAGGCTGGAGCACAGTGG - Intergenic
1063392014 10:5656059-5656081 CTGGCCATCCCTGGGCACCGGGG - Intronic
1063451810 10:6155028-6155050 ATGACTGACCTGGGGCACAGTGG - Intronic
1063891547 10:10634860-10634882 CTGGCCATCCTGGGGAACATGGG - Intergenic
1064226008 10:13485919-13485941 GTGCCCAAACTGGGGTACAGTGG + Intronic
1065550521 10:26864490-26864512 CAGTCCAGCCTGGGGGACAGAGG + Intergenic
1065958173 10:30711213-30711235 CTGTCAAACCAGGGGCAAAGGGG - Intergenic
1067011119 10:42714822-42714844 CTGGGCAAGCTGGGTAACAGAGG - Intergenic
1067263342 10:44713967-44713989 CTGGCCAGCCTGGGGCCTGGAGG - Intergenic
1067312475 10:45127021-45127043 CTGGGCAAGCTGGGCAACAGAGG + Intergenic
1067472836 10:46548791-46548813 CTGTCCAGCGTGGGGCACATCGG + Intergenic
1068820856 10:61376643-61376665 CTAGCCTACCTGGAGCCCAGAGG - Intergenic
1069272637 10:66549026-66549048 TTGCCCAGCCTGGAGCACAGTGG + Intronic
1069449698 10:68506406-68506428 CTGCCCAGGCTGGGGTACAGTGG - Intronic
1069685119 10:70312980-70313002 CTGGCCAACCTGGGGCACAGAGG - Intronic
1069909582 10:71751234-71751256 CTAGCCCAGCTGGGGGACAGTGG - Exonic
1070020918 10:72585119-72585141 CACGCCAGCCTGGGGGACAGAGG - Intronic
1070689354 10:78512996-78513018 CTGGCCAACCTAGGCCATGGTGG - Intergenic
1070787444 10:79170181-79170203 CTGGCCAATCTGGGACACACTGG + Intronic
1071481039 10:86065156-86065178 CTGGCAATCCTCTGGCACAGTGG + Intronic
1071732973 10:88267533-88267555 TTGCCCAAGCTGGAGCACAGTGG - Intergenic
1071837823 10:89437005-89437027 TTGTCCAACCTGTGGCACATGGG - Intronic
1072253785 10:93601407-93601429 CAGGACAGCCTCGGGCACAGTGG + Exonic
1072675828 10:97465341-97465363 CTGGCCAGGCTGGAGTACAGTGG + Intronic
1072783790 10:98267345-98267367 CTTGCCAGCTTGAGGCACAGAGG + Intronic
1072973785 10:100040047-100040069 CTGGCCAACATGGTGAACACAGG - Intergenic
1073098188 10:100993176-100993198 CTGGCTTGCCTGGGGAACAGGGG - Exonic
1073509273 10:104033308-104033330 CAGGCCAGCCTGGGCCACAGGGG - Exonic
1073732308 10:106304016-106304038 CTCTCCACCCTGGTGCACAGAGG + Intergenic
1074209760 10:111319814-111319836 CTGGCCTAGCTGGTGCACACTGG - Intergenic
1074232980 10:111556032-111556054 CTGGGCAAGCAGGGGCACAAAGG + Intergenic
1074771260 10:116735960-116735982 CTCTCCAGCCTGGGTCACAGAGG + Intronic
1076137702 10:128056457-128056479 CTGGGCTGCCTGGGGCCCAGCGG + Intronic
1076796322 10:132800055-132800077 CTGGCCTTCCTGGGGCATTGAGG + Intergenic
1076901592 10:133341454-133341476 CTGGCCAGGCTGGAGTACAGTGG + Intronic
1077098103 11:808391-808413 CACTCCAACCTGGGGAACAGTGG + Intronic
1077207026 11:1349618-1349640 GCGGCCAGCCTGGGGCCCAGTGG + Intergenic
1077266862 11:1655239-1655261 CCGGGCCACCTGGAGCACAGGGG + Intergenic
1077289512 11:1782416-1782438 CTGGCACCCCTGGGGCACTGGGG - Intergenic
1077477654 11:2797945-2797967 ATGGCCAACCCAGGGCACCGCGG + Intronic
1078190578 11:9090559-9090581 TTGGCTTACCTGGGCCACAGTGG - Intronic
1078442114 11:11376916-11376938 ATCCCCAACCTGGAGCACAGTGG + Intronic
1078847438 11:15132323-15132345 TTGCCCAAGCTGGGGTACAGTGG + Intronic
1079203525 11:18394862-18394884 CTGGCCACGCTGGGGAACCGAGG + Intronic
1079411809 11:20194748-20194770 TTGTCCAACCTGAGGCACACAGG + Intergenic
1080480049 11:32638518-32638540 CTCGCCAGGCTGGAGCACAGTGG + Intronic
1081938707 11:46922453-46922475 CAGGCCAACCTGGGGCCCAGAGG - Intergenic
1082059842 11:47850443-47850465 CTGGCCATGCTGGAGCACAGTGG - Intergenic
1082196817 11:49316483-49316505 CTGTCCAGCCTGGGTGACAGAGG - Intergenic
1082826929 11:57586785-57586807 CACTCCAACCTGGGGGACAGAGG + Intergenic
1083295349 11:61712383-61712405 CAGGCCATCCTGGGGGAGAGTGG + Intronic
1083889307 11:65588102-65588124 CTGCCCAGCCTGGGGATCAGAGG + Intronic
1084160628 11:67347565-67347587 TTGCCCAAGCTGGAGCACAGTGG - Intronic
1084517330 11:69643978-69644000 CTGCCCTACCTGTGGCACAGAGG - Exonic
1085505779 11:77058085-77058107 CTGTGCAATCTGGGGCCCAGAGG - Intergenic
1085619450 11:78026727-78026749 CTGCCCAAGCTGGGGTGCAGTGG - Intronic
1085690247 11:78658461-78658483 CTGGCCATCCTGGGCCTCAGTGG - Exonic
1086659007 11:89391704-89391726 CTGCCCAGCCTGGGTGACAGAGG + Intronic
1086901374 11:92371675-92371697 TTGTCCAAGCTGGAGCACAGTGG - Intronic
1087647947 11:100829579-100829601 CTGGCCACCCTAGGGGGCAGAGG - Intronic
1088274400 11:108069229-108069251 CTGCCCAAGCTGGAGTACAGTGG - Intronic
1088476881 11:110249832-110249854 CCTGCCAGGCTGGGGCACAGTGG - Intronic
1088814375 11:113411195-113411217 CTGGCTAACCTGGGTCAGAATGG - Intronic
1091150561 11:133324588-133324610 ACAGCCCACCTGGGGCACAGAGG - Intronic
1091225005 11:133951768-133951790 CTGGCCAACTGAGGGCACCGTGG + Intronic
1092255155 12:6922889-6922911 CTGGGCACCCTGGGGCTCAGGGG - Exonic
1092369327 12:7903471-7903493 CTGCCCAAACTGGGGTTCAGTGG + Intergenic
1093460698 12:19404352-19404374 CTGGGCAACCCAGGCCACAGGGG - Intronic
1093732610 12:22582955-22582977 TTGTCCAGCCTGGGGTACAGTGG - Intergenic
1094274040 12:28648365-28648387 CTGTCCAACCTTTGCCACAGAGG + Intergenic
1094367543 12:29700086-29700108 CTGCCCAAGCTGGAGTACAGTGG + Intronic
1094765092 12:33585364-33585386 CACTCCAGCCTGGGGCACAGAGG - Intergenic
1096048661 12:48586727-48586749 CTGGCAAACCAGGAGCACATCGG + Intergenic
1096423874 12:51484462-51484484 TTGACCATCCTGGGGCCCAGTGG - Intronic
1097216685 12:57419479-57419501 TTGACCAGCCTGGGGTACAGTGG + Intronic
1097679637 12:62636762-62636784 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1099363681 12:81741529-81741551 TTGTCCAACCTGGGGCCCACAGG + Intronic
1100541657 12:95562935-95562957 CTAGGCAAGGTGGGGCACAGTGG - Intergenic
1100632838 12:96405802-96405824 CTCTCCAACCTGGGTGACAGAGG - Intergenic
1101772010 12:107760763-107760785 CTGCCCAACCTGGGGGAGTGGGG + Exonic
1102428413 12:112862677-112862699 CTGTGCAATCTGGGTCACAGCGG + Intronic
1103960991 12:124609277-124609299 GGGGCCCACCTGGGGCGCAGCGG + Intergenic
1104070675 12:125342721-125342743 TTGGCCAAGCTGGGGCTCACAGG - Intronic
1104841811 12:131829220-131829242 CTGGCCGACCTGGGGTGGAGGGG - Intronic
1105719589 13:23100734-23100756 CTGGCCATGCTGGGGCACAGTGG - Intergenic
1106677385 13:31975406-31975428 TTGGCCAAGCTGGAGTACAGTGG - Intergenic
1107599781 13:42001778-42001800 CTGCCCAACCAGGGGGAAAGTGG - Intergenic
1107740472 13:43445161-43445183 TTGCCCAGGCTGGGGCACAGTGG + Intronic
1108492647 13:50996644-50996666 CTGGAGAAACTGGGGCACAGAGG - Intergenic
1109587540 13:64426277-64426299 CACTCCAACCTGGGGGACAGAGG + Intergenic
1111320877 13:86626964-86626986 TTGCCCAAGCTGGGGTACAGTGG - Intergenic
1112637629 13:101233372-101233394 CTCTCCAGCCTGGGCCACAGAGG - Intronic
1113598664 13:111552878-111552900 TTGGCCCACCTGGAGCAGAGGGG - Intergenic
1115662283 14:35508501-35508523 CAGGCCAGCCTGGGTAACAGAGG + Intergenic
1118018830 14:61689966-61689988 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1118310058 14:64685563-64685585 CTGGCCAACATGAGGCATGGAGG + Intergenic
1118852659 14:69596161-69596183 CTGGCCACCTTGGGGCCCAGAGG - Intergenic
1119487443 14:75000122-75000144 CTGCCCAAGCTGGGGTGCAGTGG + Intergenic
1119893415 14:78200065-78200087 CTGGCAAAGCTGGGGCAATGGGG + Intergenic
1120975168 14:90242022-90242044 CTGGGCACAGTGGGGCACAGTGG - Intergenic
1121317942 14:92973405-92973427 CTGGCCACCCTGTGGCGCTGTGG + Intronic
1122855172 14:104556612-104556634 TTGTCCAACCTGGAGCTCAGAGG + Intronic
1123712235 15:22997034-22997056 CTGGACACCCTGGGCAACAGTGG + Intronic
1124132259 15:27001337-27001359 CTGGCCCACCTGGGCCTCAGAGG - Intronic
1124885214 15:33678943-33678965 CTGCACAACCTGGGCCAGAGAGG + Intronic
1124937787 15:34188514-34188536 TTGCCCAACCTGGAGTACAGTGG - Intronic
1125483996 15:40099736-40099758 CTTGCCAAGCTGGAGTACAGTGG - Intronic
1125487645 15:40123425-40123447 CTGCCCAGCCTGGGACAAAGAGG + Intergenic
1125489601 15:40136773-40136795 CTGTCCAGCCTGGGACAAAGAGG + Intergenic
1125647963 15:41288882-41288904 CTGCCCAAGCTGGGGTGCAGTGG - Intergenic
1125887506 15:43239632-43239654 CTGCCCAGGCTGGAGCACAGTGG - Intronic
1126112488 15:45183893-45183915 ATGGCCAGCCTGGGCCACAGAGG + Intronic
1126141407 15:45442490-45442512 TTGCCCAAGCTGGGGTACAGTGG - Intronic
1126777503 15:52112435-52112457 CGGCCCCACCTGGGGCAGAGTGG - Exonic
1127148993 15:56054584-56054606 CACTCCAACCTGGGGGACAGAGG - Intergenic
1128109494 15:65067747-65067769 CTGGCCATCCTGGGGCGCCGCGG - Exonic
1128501283 15:68229291-68229313 CTGGGGAGCCTGGGGCCCAGCGG - Intronic
1128606600 15:69040969-69040991 CTGGTGAAGGTGGGGCACAGTGG - Intronic
1128654471 15:69450398-69450420 TTGCCCAGGCTGGGGCACAGTGG - Intergenic
1128717607 15:69920066-69920088 CCTGCCAAGCTGGGGCACGGAGG + Intergenic
1128877304 15:71212926-71212948 CTGGGCAGCATGGGACACAGAGG + Intronic
1129146840 15:73656173-73656195 CACTCCAACCTGGGCCACAGAGG - Intergenic
1129516627 15:76161291-76161313 CTGCTCTACCTGAGGCACAGGGG + Intronic
1129712313 15:77826621-77826643 CTGGGCAACCTTGGGCACAACGG - Intergenic
1131112305 15:89772746-89772768 GTGGCCAGACTGGAGCACAGTGG + Intronic
1131119592 15:89814313-89814335 CTGGCCAACACTGGGCTCAGAGG - Intronic
1131258665 15:90877327-90877349 CTGGCCCACCTGGGGCTCTGAGG + Intronic
1132070465 15:98772534-98772556 TTGGCCAGGCTGGAGCACAGTGG + Intronic
1132342133 15:101085491-101085513 CTGGCCAGGCTGGGGCTCTGGGG - Intergenic
1132390642 15:101435963-101435985 CTGGCCCACCTGTGGCCCACAGG - Intronic
1132496561 16:266199-266221 CTGGCCAGCCTGGGTCAGGGTGG + Intronic
1133224177 16:4332776-4332798 CTGGCCAACCTGGGCAGTAGAGG + Intronic
1133944290 16:10335506-10335528 CAGTCCAGCCTGGGCCACAGAGG + Intronic
1133970279 16:10562765-10562787 CTGAGCAACCTTGGGCACTGGGG - Intronic
1133999291 16:10770155-10770177 CTGGCCACCCCAGGGAACAGGGG + Intronic
1134180037 16:12040325-12040347 CTGTCCAGCCTGGGTGACAGAGG + Intronic
1134514313 16:14874322-14874344 CAGTCCAGCCTGGGGCACAGGGG - Intronic
1134701988 16:16272970-16272992 CAGTCCAGCCTGGGGCACAGGGG - Intronic
1134969843 16:18521680-18521702 CAGTCCAGCCTGGGGCACAGGGG + Intronic
1135378273 16:21969909-21969931 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1135527744 16:23227006-23227028 CACTCCAACCTGGGTCACAGAGG - Intergenic
1136172238 16:28496157-28496179 CTGGACAACCTCAGGCAAAGAGG + Exonic
1137431992 16:48426097-48426119 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1137751606 16:50865418-50865440 TTGCCCAAGCTGGGGTACAGTGG + Intergenic
1137871468 16:51954223-51954245 CTGGCCACCTTGGAGGACAGGGG + Intergenic
1138391420 16:56672703-56672725 TTGCCCAACCTGGAGTACAGTGG - Intronic
1138521781 16:57575339-57575361 CTGGCCTCCCTGGGGCCCATGGG - Intronic
1138676728 16:58656750-58656772 CACTCCAGCCTGGGGCACAGAGG + Intergenic
1139402377 16:66693284-66693306 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1139751928 16:69114188-69114210 CTGGGAAACCTGAGGCTCAGAGG - Intronic
1140442101 16:74995868-74995890 TTACCCAAGCTGGGGCACAGTGG - Intronic
1140520496 16:75576855-75576877 GTGGGCACCCTGGGGCACAGCGG + Intronic
1141330056 16:83102638-83102660 CTGGCCACCCTGGGGGAGGGTGG + Intronic
1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG + Intronic
1141452071 16:84111153-84111175 CTGGCCCACCTGGATCACCGAGG - Intronic
1141515909 16:84544820-84544842 CTGGGGACTCTGGGGCACAGAGG - Intronic
1141618051 16:85221243-85221265 CTGGCAAACCAGCCGCACAGTGG - Intergenic
1142146602 16:88495415-88495437 CAGGGCTACCTGGGGCACCGAGG + Intronic
1142229182 16:88891710-88891732 TTGGCCAACCTGGGACCCTGTGG - Intronic
1142398439 16:89846353-89846375 CAGTCCAACCTGGGTGACAGAGG - Intronic
1142651868 17:1358788-1358810 CTGGCCAGGCTGGAGTACAGTGG - Intronic
1142809697 17:2389685-2389707 CCCTCCAACCTGGGGGACAGTGG + Intronic
1143502498 17:7347433-7347455 CTGGCCAGACTAGGACACAGAGG - Intronic
1143633006 17:8149471-8149493 CCTGCCCACCTGGGGCACAGGGG - Exonic
1144992281 17:19241544-19241566 GTCGCCAAGCTGGAGCACAGTGG - Intronic
1145310274 17:21697542-21697564 CTGGGCACCCTGGGGCAGTGAGG - Intronic
1147430696 17:40368905-40368927 CAGGCCAACCTGGGCAACAGAGG + Intergenic
1147952007 17:44112605-44112627 CTGGCCAACCAAGGACACAGTGG + Intronic
1147965663 17:44193093-44193115 ACTGACAACCTGGGGCACAGAGG + Exonic
1148025924 17:44587607-44587629 CTGCCCAACCTGGAGCTCAGAGG - Intergenic
1148219544 17:45851827-45851849 CTGGGCCACCTGGGGCCCTGGGG - Intergenic
1148281737 17:46353553-46353575 TTGGCCAGGCTGGAGCACAGAGG + Intronic
1148303962 17:46571492-46571514 TTGGCCAGGCTGGAGCACAGAGG + Intronic
1148716844 17:49722057-49722079 CTGGCCAGGCTGGAGTACAGTGG - Intronic
1148864387 17:50620961-50620983 CTGGCTCACCTGGGACCCAGGGG - Intronic
1149033965 17:52114420-52114442 CTGGGCAAACTGAGGCTCAGTGG - Intronic
1149523654 17:57337534-57337556 CTGGCTAGCCTGGGTCTCAGGGG + Intronic
1149832903 17:59887330-59887352 TTGCCCAAGCTGGAGCACAGTGG - Intronic
1150432341 17:65128414-65128436 TTGCCCAAGCTGGGGTACAGTGG + Intergenic
1151776741 17:76209391-76209413 TTGTCCAACCTGCGGCCCAGGGG + Intronic
1152625469 17:81386290-81386312 CTAGACAGCCTGGGACACAGAGG - Intergenic
1152755531 17:82085497-82085519 CTGGCCATACTGCGGCTCAGTGG + Exonic
1153577306 18:6535656-6535678 CTGGTCAACCAGGGGCCCACTGG + Intronic
1153860013 18:9193175-9193197 TTGTCCAGCCTGGAGCACAGTGG + Intronic
1154193332 18:12248162-12248184 CTTCCCAGCCTGTGGCACAGGGG + Intergenic
1154501531 18:15000081-15000103 CCGGCTTACCTGGGGCGCAGCGG + Intergenic
1154971604 18:21415460-21415482 CTGCCCAGGCTGGAGCACAGTGG - Intronic
1156328568 18:36097773-36097795 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
1156592133 18:38502207-38502229 GTCGCCAAGCTGGAGCACAGTGG - Intergenic
1157713155 18:49863803-49863825 CTTGCCACCCTGGGGGACTGAGG + Intronic
1158235547 18:55309150-55309172 CTGCCCAGGCTGGAGCACAGTGG + Intronic
1158787360 18:60730780-60730802 CTCTCCAGCCTGGGGAACAGAGG + Intergenic
1158846433 18:61447765-61447787 CTGGCCATCCAGGGGAGCAGAGG - Intronic
1159075642 18:63678922-63678944 GTTGCCAGGCTGGGGCACAGTGG + Intronic
1160405726 18:78645190-78645212 CTGTCCATCCTGGTACACAGGGG - Intergenic
1160816779 19:1039755-1039777 CTGGCCAGCCCCGGGGACAGCGG + Intergenic
1160832939 19:1111880-1111902 CTGGAGAACGTGGGGCTCAGTGG - Intronic
1161394483 19:4037924-4037946 CGGGCCAGCCTCGGGCGCAGAGG + Exonic
1161507166 19:4650214-4650236 CTGGGGAACCTGCGGCTCAGAGG + Intronic
1161526127 19:4756666-4756688 CAGTCCAGCCTGGGGGACAGAGG + Intergenic
1161701434 19:5798063-5798085 CTGGGGAAACTGAGGCACAGGGG + Intergenic
1161869358 19:6858471-6858493 TTGCCCAGCCGGGGGCACAGTGG + Intergenic
1162454446 19:10774814-10774836 TTGGCCAAGCTGGAGTACAGTGG + Intronic
1162538623 19:11279473-11279495 CAGTCCAACCTGGGGGACAGAGG + Intergenic
1162654018 19:12115428-12115450 CTCTCCAACCTGGGTGACAGAGG - Intronic
1163042810 19:14615070-14615092 CTGGGCAAACTGAGGCCCAGAGG + Intergenic
1163058678 19:14742178-14742200 CTGGGCAACCTGGGAATCAGCGG - Intronic
1163290504 19:16376536-16376558 CTGGGCAAGCTGGGGCAGAGGGG + Intronic
1163342277 19:16716748-16716770 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
1163364928 19:16870590-16870612 TTGCCCAGCCTGGAGCACAGTGG + Intronic
1163658695 19:18563541-18563563 CTCGCCAGGCTGGAGCACAGTGG + Intronic
1163722057 19:18903034-18903056 CTGGGCAGCCTGGGCCTCAGTGG - Intronic
1164015312 19:21251241-21251263 TTGCCCAAACTGGAGCACAGTGG - Intronic
1164459814 19:28437242-28437264 CTGGCCAACCTGGTCCAGAATGG + Intergenic
1164529824 19:29039999-29040021 TTGGCCAGGCTGGGGTACAGTGG + Intergenic
1164736321 19:30543965-30543987 CTATCCAACAAGGGGCACAGGGG - Intronic
1164739482 19:30565796-30565818 CTGGCCAAGCTGAGGCTCAGAGG - Intronic
1164893420 19:31845723-31845745 CTCTCCAACCTGGGTGACAGAGG + Intergenic
1165737817 19:38188223-38188245 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1165876080 19:39007840-39007862 CTGGGCAACCTGGGCAACATAGG - Intronic
1166197372 19:41216025-41216047 CTGCCCACCCTAGGGCTCAGTGG - Intergenic
1166271891 19:41719594-41719616 CTGGCCAACCTGGGGACTTGTGG - Intronic
1166943643 19:46383996-46384018 CTGGCCATGCTGGGGCACCAAGG + Intronic
1167349799 19:48967467-48967489 TTGCCCAAGCTGGAGCACAGTGG - Intergenic
1167360477 19:49027804-49027826 CTGGCCAGGCTGGAGTACAGTGG + Intronic
1167365397 19:49052590-49052612 CTGGCCAGGCTGGAGTACAGTGG + Intergenic
1168012441 19:53544185-53544207 CTGGCCAAGCTGGAGTGCAGTGG - Intronic
1168200280 19:54810150-54810172 CACTCCAGCCTGGGGCACAGAGG - Intronic
1168505444 19:56930127-56930149 CTGGCCAGGCTGGAGTACAGTGG + Intergenic
925429347 2:3777879-3777901 ATGGCCACCCTGAGTCACAGTGG - Intronic
925922520 2:8647056-8647078 CAGGCCATCCTGGAGCACAAGGG + Intergenic
926221290 2:10937240-10937262 CAGGCCAAGATGGGGCAGAGTGG + Intergenic
927289578 2:21392708-21392730 CTGGGCAGCCTGGGGGACATGGG - Intergenic
927603040 2:24461260-24461282 CTGGCAAGACAGGGGCACAGAGG - Intergenic
928545029 2:32321736-32321758 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
928575145 2:32647014-32647036 TTGCCCAACCTGGAGTACAGTGG + Intronic
929881156 2:45838322-45838344 CAGGTCAGCCTGGGGCACAGAGG - Intronic
930178211 2:48321986-48322008 TTGCCCAGCCTGGAGCACAGTGG + Intronic
932786194 2:74606046-74606068 CTGCCCAGCCGGGGGAACAGAGG + Intronic
933194279 2:79371126-79371148 CTGGCAAGCCTGGGGAAGAGGGG + Intronic
933928412 2:87122734-87122756 CTGCCCAGCCTGGAGTACAGTGG - Intergenic
933931606 2:87157784-87157806 CTGCCCAGCCTGGAGTACAGTGG + Intergenic
934473753 2:94578659-94578681 CTGGCAAACATGGGACATAGAGG - Intergenic
934765791 2:96879391-96879413 CAGGGGAAGCTGGGGCACAGGGG - Intronic
934862695 2:97777773-97777795 TTGTCCAAGCTGGGGCACAGTGG - Intronic
935159229 2:100514790-100514812 CTGGGCAACATGGGCCACAGAGG + Intergenic
935782349 2:106519267-106519289 CTGGCCACCTTGGGGGATAGTGG + Intergenic
937228398 2:120382917-120382939 CTGGCCATCCAAGGTCACAGCGG - Intergenic
937322897 2:120971559-120971581 CTGGCCAGCCCAGGGCATAGGGG - Intronic
937345394 2:121122488-121122510 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
937698164 2:124832944-124832966 CTCTCCAGCCTGGGGGACAGAGG - Intronic
937927256 2:127176772-127176794 CTGGAGAGCCTGGGGCACCGAGG + Intergenic
938500713 2:131830263-131830285 CCGGCTTACCTGGGGCGCAGCGG + Intergenic
940307155 2:152238758-152238780 TTGCCCAGCCTGGGGTACAGTGG - Intergenic
941204749 2:162558212-162558234 CTGGCCAGGCTGGAGTACAGTGG + Intronic
941519501 2:166521720-166521742 TTGCCCAAGCTGGGGTACAGTGG - Intergenic
941926718 2:170902891-170902913 CTGTCCAACCTGGAGTGCAGTGG + Intergenic
941968593 2:171325223-171325245 CTGCCCAGGCTGGAGCACAGTGG + Intronic
944767498 2:202879458-202879480 CTGCCCAGGCTGGAGCACAGTGG + Exonic
944992225 2:205250887-205250909 TTGCCCAGGCTGGGGCACAGTGG - Intronic
945066955 2:205955641-205955663 TTGCCCAAGCTGGGGTACAGTGG + Intergenic
946419763 2:219558151-219558173 CTGGCCAACCCAGGGCAGGGAGG - Intronic
947914693 2:233823593-233823615 CTGGCCGAGCTGGTGCTCAGGGG + Exonic
948518267 2:238519733-238519755 CCGGCAACCCTGGGCCACAGAGG + Intergenic
1169508902 20:6242933-6242955 CTGGCCAAGATGAGGCAGAGAGG + Intergenic
1170470183 20:16661011-16661033 CTGCCCAGCCTGGGCAACAGAGG - Intergenic
1170957903 20:20998149-20998171 CTGGCCTCCCTGGGGCTCTGTGG - Intergenic
1172856004 20:38002998-38003020 CTGTCCAAGCTGGAGTACAGTGG + Intronic
1172885368 20:38227474-38227496 ATGGGCAAACTGGGGCCCAGAGG - Intronic
1173737126 20:45370212-45370234 CTGGCCAATGCTGGGCACAGTGG - Intronic
1174404223 20:50293278-50293300 CTGGAGAAACTGAGGCACAGAGG + Intergenic
1174867530 20:54151858-54151880 CTGGGGAAACTGAGGCACAGAGG - Intergenic
1175893166 20:62324196-62324218 CTGGCAGTCCTGGGGCAGAGTGG + Exonic
1176658666 21:9613396-9613418 CTGGCCAACATAGGGCAAGGTGG - Intergenic
1176954942 21:15091395-15091417 CTGGCCATCCTGGGGCACTATGG - Intergenic
1177720043 21:24893868-24893890 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1178337185 21:31753863-31753885 AAGGCCAACCTGGGCCACATGGG + Intergenic
1179904974 21:44418141-44418163 CTGGCCACCCGGGTGCAGAGGGG + Intronic
1180207042 21:46267221-46267243 ATGGCCAGCGTGGGGCACATGGG + Intronic
1180844524 22:18973899-18973921 CAGGCCAGCCTGGGGATCAGAGG - Intergenic
1181183053 22:21080646-21080668 CTAGCCCACCTGGAGCACCGTGG + Intergenic
1182221495 22:28762304-28762326 TTGCCCAATCTGGAGCACAGTGG + Intergenic
1182486226 22:30640714-30640736 CTGGGCAACCTTGGGCATATTGG + Intronic
1182775936 22:32830961-32830983 TTCCCCAACCAGGGGCACAGGGG + Intronic
1183381884 22:37494285-37494307 CTGGCAAGCCTGGACCACAGTGG - Intronic
1184870786 22:47237175-47237197 GTGGGGAACCTGAGGCACAGGGG + Intergenic
1184982223 22:48102761-48102783 CTGGCCTCCCAGGGCCACAGTGG + Intergenic
1185044836 22:48523643-48523665 CTGGCCCAAGTTGGGCACAGAGG - Intronic
1185288299 22:50011990-50012012 CCGGCCAGCCTTGGGCACCGGGG + Intronic
949568628 3:5269749-5269771 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
949843041 3:8340660-8340682 GTTGCCAGCCTGGAGCACAGTGG - Intergenic
950138958 3:10601995-10602017 CTGGACAACCTGAGGCCCAGTGG + Intronic
950454105 3:13082540-13082562 CTGGCCAGCCTGGAGGTCAGAGG + Intergenic
950522635 3:13505786-13505808 CTGGCCCACCTGGGGCCCCTGGG - Exonic
950886457 3:16366835-16366857 CTGGCAAGCTTAGGGCACAGAGG - Intronic
951300163 3:20986816-20986838 TTGGCCAAGCGGGGGCACTGAGG - Intergenic
952381220 3:32806946-32806968 TTGCCCAACCTGGAGTACAGTGG - Intergenic
953049255 3:39325825-39325847 CAGTCCAGCCTGGGCCACAGAGG + Intergenic
953660641 3:44889131-44889153 CTGGCCAGCCTGGGCAACACAGG + Intronic
954353409 3:50064715-50064737 TTGGCCAGGCTGGAGCACAGTGG + Intronic
954646624 3:52135621-52135643 CTGGCAGACCTGGGTCCCAGGGG + Intronic
954653922 3:52182418-52182440 GTGTCCAGGCTGGGGCACAGGGG - Intergenic
954842120 3:53521077-53521099 CTGGCCATACTGGAGTACAGTGG + Intronic
954902358 3:54030846-54030868 CTGGCACACCTCTGGCACAGTGG - Intergenic
956416639 3:69037764-69037786 CTTGCCAGACTGGAGCACAGTGG - Intronic
958930018 3:100198422-100198444 CTGCCCAAGCTGGAGTACAGTGG - Intergenic
960514157 3:118584509-118584531 GTGACCAAACTGAGGCACAGAGG + Intergenic
961352901 3:126315435-126315457 CTCCCCCATCTGGGGCACAGTGG - Intergenic
963235623 3:142953089-142953111 TTGGCCATCCTAGGCCACAGGGG + Intronic
965147754 3:164928118-164928140 CTGGCAAATCTGGGGCAGTGAGG + Intergenic
965484795 3:169265629-169265651 CTGGCCAGCCTTGAGCACAATGG + Intronic
965509200 3:169549585-169549607 CTGGGCAAGCTGTGGCACTGGGG - Intronic
966899511 3:184470112-184470134 TTGCCCAAGCTGGAGCACAGTGG - Intronic
967067736 3:185935515-185935537 CTGGAAAAGGTGGGGCACAGAGG + Intronic
967097607 3:186190080-186190102 CTGGGGAAACTGAGGCACAGAGG + Intronic
967249853 3:187526268-187526290 CTGCCCAAGCAGGAGCACAGTGG + Intergenic
968330648 3:197866781-197866803 TTGGCCAAGCTGGAGAACAGTGG - Intronic
968511049 4:996135-996157 CAGCCCAACCTGGGCCCCAGTGG + Intronic
968549781 4:1216286-1216308 ATGGTCAAACTGAGGCACAGAGG - Intronic
968636940 4:1685394-1685416 CTGGCCACCGTGGGGCTCGGTGG + Intergenic
968797846 4:2720609-2720631 TTGCCCAAGCTGGAGCACAGTGG - Intronic
969518507 4:7662069-7662091 CTGGCCAACCTCGGGGCCCGAGG + Intronic
970363786 4:15337612-15337634 CTGGCCAGCCTGGGCATCAGTGG - Intergenic
971185654 4:24373224-24373246 CTGGCGATACTGGGGCAAAGAGG + Intergenic
971366735 4:25983656-25983678 CAGGCAATGCTGGGGCACAGTGG + Intergenic
971445986 4:26749484-26749506 TGGCCCAACCTGGGGTACAGTGG + Intronic
971664447 4:29463917-29463939 TTGGCCAACCTGGAGTGCAGTGG - Intergenic
971916099 4:32871822-32871844 CTGGTCAAACTGGAGGACAGAGG + Intergenic
974048040 4:56913680-56913702 CACTCCAGCCTGGGGCACAGAGG - Intronic
974340366 4:60607594-60607616 CTTTCCAATCTGGGGGACAGTGG - Intergenic
978657916 4:111088542-111088564 CTCGCCAGTTTGGGGCACAGTGG - Intergenic
979053838 4:115971152-115971174 TTGCCCATCCTGGGGTACAGTGG - Intergenic
979630631 4:122898918-122898940 CTGGCCAGCCTGGAGTGCAGTGG + Intronic
981610190 4:146585373-146585395 TTGTCCAACCTGTGGCCCAGAGG - Intergenic
982172472 4:152675115-152675137 CTGCCCAGGCTGGAGCACAGTGG - Intronic
984077432 4:175200819-175200841 TTGCCCAGGCTGGGGCACAGTGG + Intergenic
984528724 4:180889308-180889330 CTGCCCAGGCTGGGGCACACTGG - Intergenic
985525842 5:401255-401277 GGGGCCAGCCTGAGGCACAGTGG + Intronic
985705305 5:1397117-1397139 CTGGAGGACCTGGGGCAAAGTGG + Intronic
985911062 5:2883728-2883750 CTCTCCAGCCTGGGGGACAGAGG - Intergenic
987114485 5:14715102-14715124 CTGGCCTACCTGGGGCTCCATGG + Intronic
987202577 5:15591995-15592017 GTGGCCAACCTCGGGCACGGTGG - Intronic
988484772 5:31659494-31659516 CTGACCAAGCTGGGGAGCAGAGG - Intronic
988518578 5:31926178-31926200 TTGCCCAGGCTGGGGCACAGTGG - Intronic
990496584 5:56354138-56354160 CTTGCCCACCTGGGGAACTGTGG - Intergenic
990753249 5:59039989-59040011 CTGGGCAACCTGGAGGGCAGTGG - Intronic
990960168 5:61385760-61385782 ATGCACACCCTGGGGCACAGGGG - Intronic
991708091 5:69379194-69379216 TTGCCCAGGCTGGGGCACAGTGG - Intronic
992435910 5:76755971-76755993 GAGGCCTACCTGGGGCACAGAGG - Intergenic
995093185 5:108204948-108204970 TTGCCCAAGCTGGAGCACAGTGG + Intronic
995618047 5:113989246-113989268 CTGCCCAGGCTGGAGCACAGTGG - Intergenic
996653310 5:125909158-125909180 CTGGCCCACATGAGGCCCAGAGG + Intergenic
997350059 5:133224682-133224704 CAGGCCTACCTGGGGAGCAGTGG + Intronic
997459904 5:134044910-134044932 CTGGCCATCCTGGGGAAGGGAGG + Intergenic
997657632 5:135567171-135567193 CTGGGCACCATGGGGAACAGAGG - Intergenic
997706012 5:135953239-135953261 GTTGCCAAGCTGGAGCACAGTGG + Intronic
997955957 5:138278804-138278826 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
999150600 5:149423817-149423839 CTGGACAACCTGGGCAACTGGGG - Intergenic
999297459 5:150468601-150468623 CTGGCCGGCCTGTGGCATAGGGG - Intergenic
999378527 5:151103851-151103873 CTGGCCAGTCCTGGGCACAGAGG - Intronic
999914221 5:156239364-156239386 CCCTCCAACCTGGGCCACAGAGG + Intronic
1000466613 5:161586556-161586578 CTGGCCAGGCTGGAGCACAGTGG - Intronic
1002913083 6:1506004-1506026 GTGGTCAGCCCGGGGCACAGCGG - Intergenic
1003441689 6:6148592-6148614 CTTGGCAACATAGGGCACAGTGG + Intronic
1003524456 6:6886278-6886300 CTGGCCAGCCTGGAGCATGGAGG - Intergenic
1003614450 6:7642451-7642473 TTGCCCAAGCTGGAGCACAGTGG + Intergenic
1004957490 6:20745802-20745824 CTGGGCCACGTGGGGCCCAGAGG + Intronic
1005357511 6:24998782-24998804 CTGGCCAACCTTGGGCCGATTGG - Intronic
1005657082 6:27950760-27950782 GTGGGCAATCTGGAGCACAGAGG - Intergenic
1006183739 6:32168903-32168925 CTGGCCAATGTGGGGTAGAGGGG + Exonic
1006477695 6:34268315-34268337 TTGCCCAAGCTGGAGCACAGTGG - Intergenic
1007449068 6:41929462-41929484 CATGCCAACCTGGGCAACAGAGG + Intronic
1007603120 6:43096222-43096244 CTCTCCAACCTGAGGCTCAGGGG - Intronic
1009535984 6:64886697-64886719 CTGTATAACCAGGGGCACAGAGG + Exonic
1011637274 6:89386047-89386069 CTGGCCAACCTGTCTCACTGTGG + Intronic
1011799740 6:90998914-90998936 CACTCCAACCTGGGCCACAGAGG - Intergenic
1012107024 6:95175354-95175376 CTGACCTACCTGAGCCACAGTGG + Intergenic
1012281518 6:97332889-97332911 TTGCCCAAGCTGGAGCACAGCGG - Intergenic
1013210539 6:107983000-107983022 CTGGATATCGTGGGGCACAGAGG + Intergenic
1013609150 6:111778072-111778094 CTGGCCCACGAGGAGCACAGAGG - Intronic
1013840013 6:114380401-114380423 CTGACCAGGCTGGAGCACAGTGG + Intergenic
1014098228 6:117482755-117482777 CTTGCCAAGCTGGCGCCCAGCGG + Exonic
1014214101 6:118736431-118736453 CAGTCCAGCCTGGGGGACAGAGG + Intergenic
1015374685 6:132496438-132496460 ATGGGAAAGCTGGGGCACAGAGG - Intronic
1016048906 6:139509186-139509208 CTGCCCAACCTGGAGTGCAGCGG + Intergenic
1016928661 6:149380199-149380221 CTGCCCAGGCTGGGGCAGAGTGG - Intronic
1016948231 6:149553953-149553975 CTGCCCAGACTGGAGCACAGTGG - Intergenic
1017114538 6:150964842-150964864 CAGGCAACCCTGGGCCACAGGGG - Intronic
1017123220 6:151043715-151043737 CTGGCAAACATGGGACATAGAGG + Intronic
1017726338 6:157278515-157278537 CTGGCCCTCCTGAGGCCCAGAGG - Intergenic
1022259758 7:28692614-28692636 CAGGCCAACCTCGGGCATGGTGG + Intronic
1023275141 7:38510732-38510754 CTTTACAGCCTGGGGCACAGAGG - Intronic
1023861625 7:44220490-44220512 CTGGCCAACCCTGGGCACAGAGG + Intronic
1026793919 7:73353771-73353793 TTGCCCAGCCTGGAGCACAGTGG + Intronic
1027478623 7:78666568-78666590 TTGGCCAACCAGGGGGACACTGG + Intronic
1027509691 7:79064892-79064914 CTGACCAAAGTGGGGCAAAGAGG - Intronic
1027635138 7:80662364-80662386 CTCCCCAACCTGGGACACCGGGG + Intronic
1028559509 7:92158314-92158336 TTGCCCAAGCTGGAGCACAGTGG - Intronic
1029144358 7:98435146-98435168 CACTCCAACCTGGGCCACAGAGG + Intergenic
1029244855 7:99191687-99191709 TTGCCCAGGCTGGGGCACAGTGG + Intronic
1029287964 7:99479061-99479083 CTGGCCACCCTGGGGAACCAGGG - Intronic
1029356220 7:100053897-100053919 CTGGCCAACATGGTGAACTGGGG - Intronic
1029360176 7:100082544-100082566 GTGGCCAGCCTGGAGTACAGTGG - Intronic
1029437974 7:100573288-100573310 CTGTCCTACCTGGGGCTCCGGGG + Exonic
1030406332 7:109118794-109118816 TTGCCCAAGCTGGAGCACAGTGG - Intergenic
1030624670 7:111831516-111831538 CTCTCCAACCTGGGCAACAGAGG - Intronic
1031610490 7:123820541-123820563 TTGCCCAAGCTGGGGCACAATGG - Intergenic
1032273327 7:130431750-130431772 CTGGCCGGCCTGGAGCATAGCGG + Intronic
1032577593 7:133072128-133072150 TTGCCCAAGCTGGAGCACAGTGG - Intronic
1033377137 7:140772589-140772611 CTGTCCAGCCTGGGTGACAGAGG + Intronic
1033449003 7:141446377-141446399 CTGGCGAACATGTGGCACTGTGG - Intronic
1034345637 7:150383823-150383845 CTGCCCGACCTGGGGCGCTGAGG + Intronic
1035855928 8:2976400-2976422 CTGGCCAGCCTGGAGTGCAGTGG + Intronic
1036006727 8:4673413-4673435 CTTTCCAACCTAGGGCCCAGAGG + Intronic
1036790154 8:11711925-11711947 CTGGCCATCTTAGGGCTCAGTGG - Intronic
1036796839 8:11762276-11762298 CTGGTTAACTTGGAGCACAGCGG - Exonic
1037840578 8:22242509-22242531 CAGTCCAACCTGGGTGACAGAGG - Intergenic
1039193157 8:34999887-34999909 CTGGCCGTCTTGGGGCACTGAGG + Intergenic
1039618326 8:38974552-38974574 CTGGGGAACCCGGGGCGCAGCGG - Exonic
1040412632 8:47169693-47169715 TTGCCCAGCCTGGAGCACAGTGG + Intergenic
1041668259 8:60467004-60467026 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1042328006 8:67548289-67548311 TTGCCCAGCCTGGAGCACAGCGG + Intronic
1043139159 8:76566254-76566276 CTAGGCAACCAGAGGCACAGAGG + Intergenic
1045130319 8:99144447-99144469 TTGGCCAGGCTGGAGCACAGTGG - Intronic
1048740552 8:137554477-137554499 TTGCCCAACCTGGGGTTCAGTGG + Intergenic
1048937576 8:139369724-139369746 ATGGCCATCCTGGGGCATGGAGG + Intergenic
1048978509 8:139689680-139689702 CTGCCCAAGCTGGAGCGCAGTGG + Intronic
1049441689 8:142612563-142612585 CTGGCCAGCCTCGGGCAGCGCGG - Exonic
1049495306 8:142928134-142928156 CTGGCCAAACTCAGACACAGGGG - Intergenic
1050346652 9:4695531-4695553 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1050695838 9:8278169-8278191 CTCCCCAGCCTGGGGCTCAGTGG - Intergenic
1050709371 9:8442939-8442961 CTGTCCAGCCTGGGCAACAGAGG + Intronic
1051241096 9:15056749-15056771 TTGCCCAGGCTGGGGCACAGTGG - Intergenic
1051969914 9:22876272-22876294 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1052317925 9:27135650-27135672 ATGACCAATCTGAGGCACAGAGG + Intronic
1052395946 9:27938287-27938309 CTGGCAAACCTGGGGCTCCCAGG + Intergenic
1052928334 9:34036847-34036869 CTGCCCAGGCTGGAGCACAGTGG + Intronic
1053079962 9:35167409-35167431 TTGGCTACCCTGGGCCACAGTGG - Intronic
1053106093 9:35409768-35409790 CAGTCCAACCTGGGTGACAGAGG + Intergenic
1053199052 9:36140485-36140507 ATGGGAAACCTGGGGCCCAGAGG + Intronic
1053455191 9:38228146-38228168 TTGTCCAAGCTGGGGTACAGTGG + Intergenic
1053684577 9:40509853-40509875 CTGGCAAACATGGGACATAGAGG + Intergenic
1053934544 9:43138131-43138153 CTGGCAAACATGGGACATAGAGG + Intergenic
1054279148 9:63115108-63115130 CTGGCAAACATGGGACATAGAGG - Intergenic
1054297673 9:63345315-63345337 CTGGCAAACATGGGACATAGAGG + Intergenic
1054395688 9:64649826-64649848 CTGGCAAACATGGGACATAGAGG + Intergenic
1054430332 9:65155021-65155043 CTGGCAAACATGGGACATAGAGG + Intergenic
1054500048 9:65866500-65866522 CTGGCAAACATGGGACATAGAGG - Intergenic
1054986138 9:71263817-71263839 TTGCCCAAGCTGGAGCACAGTGG + Intronic
1055455184 9:76465561-76465583 CTGGCCTAGCTGGGACACAGTGG - Intronic
1056196898 9:84237828-84237850 GTGGCCAGGCTGGAGCACAGTGG - Intergenic
1056379848 9:86047225-86047247 AGGGCCAAGCTGGGGCAGAGGGG + Intronic
1057064798 9:92038649-92038671 CAGGCCAAGGTGGGGCCCAGAGG - Intronic
1057414300 9:94847441-94847463 TGGGAAAACCTGGGGCACAGAGG + Intronic
1058850759 9:109010060-109010082 TTGGCCAGGCTGGAGCACAGTGG + Intronic
1059298080 9:113290178-113290200 TTGCCCAGCCTGGAGCACAGTGG - Intronic
1059528694 9:115016352-115016374 CTGACCTCTCTGGGGCACAGAGG + Intergenic
1059740408 9:117144405-117144427 TTGTCCAACCTGCGGCCCAGGGG + Intronic
1060370120 9:123061156-123061178 CTGCCCAGGCTGGAGCACAGTGG + Intronic
1060881880 9:127123089-127123111 CCCGCCAGCCTGGGGCTCAGTGG - Intronic
1061177423 9:129006172-129006194 CTGGCCAAGCTTGAGAACAGTGG - Intronic
1061576384 9:131509620-131509642 CTGGCCATGCTGAGCCACAGGGG - Intronic
1062062288 9:134502937-134502959 GAGGCCATCCTGGGGCCCAGGGG + Intergenic
1062340662 9:136092627-136092649 CTGGTCAGCCTGGGCCACTGAGG + Intronic
1062498968 9:136844266-136844288 CCGGCTTACCTGGGGCGCAGCGG - Intronic
1062516744 9:136940685-136940707 CTGGGCAACTTGGGGTACACAGG - Exonic
1203636393 Un_KI270750v1:116975-116997 CTGGCCAACATAGGGCAAGGTGG - Intergenic
1185489195 X:507894-507916 CTGCCCACGCTGGAGCACAGTGG + Intergenic
1186265422 X:7827827-7827849 CTGGCCAAGTTGGAGCACTGAGG + Intergenic
1187038772 X:15570711-15570733 CTGTCCAAGCAGGGGCACAAGGG - Intronic
1189363617 X:40371536-40371558 CAGGCTCACCTGAGGCACAGTGG - Intergenic
1189496937 X:41517100-41517122 CAGGCCTGCCTGGAGCACAGGGG + Intronic
1189971043 X:46418569-46418591 CTGGCAAATCTGGGGGACACTGG + Intergenic
1190077550 X:47328912-47328934 TTGCCCAGGCTGGGGCACAGTGG + Intergenic
1192723924 X:73728077-73728099 GTCGCCAAGCTGGGGCCCAGTGG - Intergenic
1194388188 X:93282893-93282915 CTGCCCAGGCTGGGGTACAGTGG - Intergenic
1194723318 X:97365743-97365765 CTGTCCAGGCTGGGGTACAGTGG + Intronic
1196790641 X:119461250-119461272 TTGCCCAACCTGGAGTACAGTGG - Intergenic
1197240550 X:124118585-124118607 CTCTCCAGCCTGGGGGACAGAGG + Intronic
1198679794 X:139169507-139169529 TTGCCCAAGCTGGGGTACAGAGG + Intronic
1200210369 X:154344382-154344404 CTGCCCCACCTGGGGCAGAGAGG - Intergenic
1200220483 X:154387710-154387732 CTGCCCCACCTGGGGCAGAGAGG + Intergenic
1202123858 Y:21552118-21552140 CTGCCCAGGCTGGAGCACAGTGG + Intergenic
1202155150 Y:21877262-21877284 CTGCCCAGGCTGGAGCACAGTGG - Intergenic
1202160039 Y:21924375-21924397 CTGCCCAGGCTGGAGCACAGTGG - Intergenic