ID: 1069685122

View in Genome Browser
Species Human (GRCh38)
Location 10:70312988-70313010
Sequence CACCCTTGCTGGCCAACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069685122_1069685131 -4 Left 1069685122 10:70312988-70313010 CCCCAGGTTGGCCAGCAAGGGTG 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1069685131 10:70313007-70313029 GGTGGGCTAATGGGCATTGAGGG No data
1069685122_1069685130 -5 Left 1069685122 10:70312988-70313010 CCCCAGGTTGGCCAGCAAGGGTG 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685122_1069685133 -2 Left 1069685122 10:70312988-70313010 CCCCAGGTTGGCCAGCAAGGGTG 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1069685133 10:70313009-70313031 TGGGCTAATGGGCATTGAGGGGG No data
1069685122_1069685132 -3 Left 1069685122 10:70312988-70313010 CCCCAGGTTGGCCAGCAAGGGTG 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1069685132 10:70313008-70313030 GTGGGCTAATGGGCATTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069685122 Original CRISPR CACCCTTGCTGGCCAACCTG GGG (reversed) Intronic
900092552 1:926728-926750 AACCCTTGCTGCCCAACTAGGGG - Intronic
900422750 1:2562654-2562676 CACCCATGCTGGGCCTCCTGGGG + Intronic
901012708 1:6210396-6210418 CAGCCTTGTTGGCCAAGCTGAGG - Exonic
901366602 1:8756801-8756823 CACCATGTCTGGCCAACATGTGG - Intronic
902349799 1:15846269-15846291 CACTCTTGTTAGCCAAGCTGGGG - Intergenic
903647415 1:24903615-24903637 CACCCTTGATGGGGAAACTGAGG + Intronic
904482869 1:30805215-30805237 CCACCTTGCTGGCCTATCTGGGG + Intergenic
905112917 1:35610535-35610557 CACCATTGCTCTCCAGCCTGGGG - Intronic
906722587 1:48019892-48019914 CAGCCTTGTTGCCCAACTTGAGG + Intergenic
907208156 1:52793457-52793479 CACTCTTGTTGCCCAAGCTGGGG - Intronic
910337314 1:86149181-86149203 CACCATGCCTGGCCCACCTGGGG + Intronic
912943898 1:114068852-114068874 CACCTTTACTGGCCTACCTCAGG - Intergenic
914289147 1:146256995-146257017 CACCATTGCACTCCAACCTGGGG + Intergenic
914738879 1:150446715-150446737 CACTCTTGTTGGCCAGGCTGGGG - Intronic
915488749 1:156239965-156239987 CCCCCTTGCTGGCCAGCCCAGGG + Intronic
917147454 1:171907457-171907479 CACTCTTGCTGCCCAGGCTGGGG - Intronic
919993308 1:202724440-202724462 CACTCTTGTTGTCCAAGCTGTGG - Intergenic
920419374 1:205820936-205820958 CACTCTTGTTGCCCAAGCTGGGG + Intergenic
922798104 1:228351492-228351514 CATCCTTGCTGGCCATCCTCTGG + Intronic
922908938 1:229199428-229199450 CACCATTGCTGCCTCACCTGAGG + Intergenic
923621308 1:235581673-235581695 CATGCTTGCTGGACCACCTGTGG + Intronic
1062901074 10:1147532-1147554 CATCCTTGCTGGCACCCCTGGGG + Intergenic
1063335936 10:5213310-5213332 CACCCATGCTGCCCCTCCTGTGG - Intronic
1064032747 10:11893664-11893686 CATCTTTGCTGGCCAGACTGAGG - Intergenic
1065340403 10:24699364-24699386 CACCATTGCACGCCAGCCTGGGG - Intronic
1068080070 10:52308953-52308975 CTACCTGGCTGGCCAACCTAGGG - Intergenic
1069555721 10:69396711-69396733 CACTCTTGTTGGCCAGGCTGGGG + Intronic
1069685122 10:70312988-70313010 CACCCTTGCTGGCCAACCTGGGG - Intronic
1069728500 10:70596403-70596425 CACCCCTCCTGTCCCACCTGGGG + Intergenic
1069952884 10:72031722-72031744 TTCCCTGGCTGGGCAACCTGGGG + Intergenic
1070542808 10:77428932-77428954 CACCCCTAGTGGCCAAGCTGGGG - Intronic
1073020986 10:100443868-100443890 CAACATTGCTGGCCCACCTGTGG + Intergenic
1073374090 10:103017920-103017942 CACCATTGCTCTCCAGCCTGGGG + Intronic
1076874558 10:133209717-133209739 CACCTTTGCAGGGCAGCCTGGGG + Intronic
1077036399 11:496901-496923 CAGCCTACCTGGCCACCCTGTGG - Intronic
1077401092 11:2357851-2357873 CACCCTCGCCGCCCCACCTGAGG + Intergenic
1077649118 11:3953568-3953590 CTTCTTTGCTGGCCAACCTAGGG + Intronic
1080583885 11:33665038-33665060 CACCCTCTCTGGTCAGCCTGAGG + Intronic
1082847254 11:57736438-57736460 CAACCTTCTTGTCCAACCTGTGG - Intronic
1083310083 11:61779552-61779574 CTACCTTGCTGGCCACCTTGGGG - Exonic
1083408521 11:62475259-62475281 CACCATTGCACTCCAACCTGGGG + Intronic
1083641059 11:64145559-64145581 CACCCCTGCTGGCCACTCCGTGG - Intronic
1083871561 11:65491284-65491306 CGCCCTGGCTGCCCATCCTGTGG - Intergenic
1084626428 11:70311274-70311296 CACTCTTGCTGTCCAGGCTGGGG - Intronic
1086725092 11:90172240-90172262 CACCCTTCCTCACCAACATGAGG - Intronic
1088017433 11:105077905-105077927 CACTCTTGCTGCCCAGGCTGTGG + Intronic
1090062106 11:123473104-123473126 CACCATTGCTCTCCAGCCTGGGG - Intergenic
1091739407 12:2949596-2949618 CAGCTGTGCTGGCCAACATGTGG + Intergenic
1092564662 12:9651425-9651447 CATGCTTCCTGGCCAGCCTGTGG - Intergenic
1096669528 12:53190288-53190310 GACCCCTGCTGGCCAGCATGGGG + Exonic
1096685940 12:53288336-53288358 CACCCTTGCTGTCCTACCTGAGG - Exonic
1097218758 12:57434498-57434520 TACCCTTGCTGGGAATCCTGGGG - Intergenic
1098702943 12:73652254-73652276 CATCCTTTCTGCACAACCTGTGG + Intergenic
1099322058 12:81162701-81162723 CACCCTGGCTGTCCATGCTGAGG + Intronic
1100587066 12:95990335-95990357 CACAGTTGGTGTCCAACCTGGGG + Intronic
1101336603 12:103802291-103802313 CACCCTCCATGGCCAACTTGTGG - Intronic
1102099580 12:110268186-110268208 CACTCTTGCTGCCCAAGCAGTGG + Intergenic
1102460818 12:113098508-113098530 AACCCCTGCTGGCCACCCTCGGG + Intergenic
1102791968 12:115654282-115654304 CACCATGCCTGGCCCACCTGGGG - Intergenic
1103053571 12:117801476-117801498 CATCCTTCCTGGACAGCCTGAGG - Intronic
1106479789 13:30128595-30128617 CCCCCTTGCTGGCCAGCCCAGGG - Intergenic
1106679725 13:31997646-31997668 CAACCTGGCTGCCCAAACTGAGG - Intergenic
1107517264 13:41142795-41142817 CACCATTGCACTCCAACCTGGGG - Intergenic
1108138596 13:47393397-47393419 CACCCTTCCTGTACAGCCTGTGG - Intergenic
1112111447 13:96304099-96304121 CACCATTGCACTCCAACCTGGGG + Intronic
1113604504 13:111595759-111595781 CACCCTTGCAGGCCTTCCTGCGG + Intronic
1115026389 14:28751765-28751787 CATTCTTGCTGGCCACCCTGTGG - Intergenic
1115283726 14:31694141-31694163 CACCGTGCCTGGCCAACATGAGG + Intronic
1117268214 14:54113191-54113213 CATCCTTCCTGTGCAACCTGTGG + Intergenic
1126058294 15:44753745-44753767 CACTCTTGTTGCCCAAGCTGGGG + Intronic
1126109771 15:45168426-45168448 GACCCCTGCTGGCCAACCCTGGG + Intronic
1126957191 15:53946486-53946508 CACCCATGCTGGATCACCTGAGG + Intergenic
1127462888 15:59215881-59215903 CCCCCTTGCTGACCAGCCTTGGG + Intronic
1128539802 15:68518616-68518638 CACCCTTGCTGCCAGACTTGGGG + Intergenic
1129971280 15:79780160-79780182 CACCTTTGCTGGGGATCCTGGGG - Intergenic
1130090738 15:80819112-80819134 CAGCCTTTCTGGCTAGCCTGTGG - Intronic
1130850626 15:87790310-87790332 CTCCCTAGCTGGGCAACCTTGGG + Intergenic
1131510857 15:93048792-93048814 CACCCTGGCTGGCCCACCTCCGG - Intronic
1132082690 15:98880766-98880788 GACCCTTGCTGATAAACCTGTGG - Intronic
1132324613 15:100958431-100958453 CACCCTTGCTGGGCTTGCTGGGG - Intronic
1133218777 16:4309284-4309306 CAACCTTTCTGGAAAACCTGAGG - Intergenic
1134390693 16:13817182-13817204 GACCTTTGCTGCTCAACCTGGGG - Intergenic
1135555502 16:23432942-23432964 CTCCCTTGCTGGACAACAGGCGG + Intronic
1138947871 16:61874012-61874034 CACCATTGCTCTCCAGCCTGGGG + Intronic
1139506588 16:67401099-67401121 CATCTTTGCTGGCCACCTTGTGG - Exonic
1141409789 16:83825237-83825259 CACCCTGGCTGGACACCCAGGGG - Intergenic
1142647072 17:1321139-1321161 CACCATTGCTCTCCAGCCTGGGG + Intergenic
1143333943 17:6158563-6158585 CACCATTGCCTTCCAACCTGGGG + Intergenic
1145787442 17:27603378-27603400 CGGCCTTGCTGGCCAAAGTGAGG + Intronic
1146741447 17:35287773-35287795 CACCATTGCTGGCTAACTTTTGG + Intergenic
1147375490 17:40020240-40020262 CACCCCTGCTGCCGAACCTGGGG - Intronic
1148036870 17:44670219-44670241 CACCATTGCATTCCAACCTGGGG + Intronic
1148123173 17:45224024-45224046 CACCCTCTCTGACCCACCTGTGG - Intronic
1149498434 17:57133823-57133845 GACCCTTGCTGGGTATCCTGGGG - Intergenic
1151386974 17:73760918-73760940 CATCCTTGGTGACCTACCTGGGG + Intergenic
1152428297 17:80231202-80231224 CACCATTGCACTCCAACCTGGGG - Intronic
1152518993 17:80844585-80844607 CACACTTGGAGGGCAACCTGTGG - Intronic
1152602225 17:81269930-81269952 CACTCTTGTTGCCCAAGCTGGGG - Intronic
1153952680 18:10070364-10070386 CATCCTTGCTGGCCTTGCTGAGG + Intergenic
1156312850 18:35940676-35940698 CATCATACCTGGCCAACCTGGGG - Intergenic
1159287699 18:66374803-66374825 TACCCTTGCTGTCCTACCTCAGG + Intergenic
1161138732 19:2635869-2635891 CACCGTGCCTGGCCAACTTGGGG + Intronic
1161602119 19:5190655-5190677 CATCCTTGCTGTCCCACCTCTGG - Intronic
1162395421 19:10415784-10415806 CACCGCATCTGGCCAACCTGCGG + Intronic
1162874924 19:13614000-13614022 CACCATTGCTCTCCAGCCTGGGG + Intronic
1164800595 19:31073167-31073189 CAACCTTGGTGGCCCACCTTAGG - Intergenic
1165702077 19:37946111-37946133 CACCATTGCACTCCAACCTGGGG + Intronic
1166062640 19:40336250-40336272 CACCCACTCTGGCCCACCTGGGG - Intronic
1166074647 19:40406813-40406835 CACCATTGCATGCCAGCCTGAGG - Intronic
1166832211 19:45645503-45645525 CCCCCTTTCTGGGCATCCTGGGG - Exonic
1167737380 19:51303908-51303930 CACCCTATCTGGCAAAACTGGGG - Intergenic
1168007787 19:53505327-53505349 CACCATTGCACTCCAACCTGGGG - Intergenic
925291501 2:2751342-2751364 CACCTTTGCTGGCAACGCTGCGG + Intergenic
926341658 2:11909236-11909258 CATCCCTGCTGGCCTGCCTGGGG + Intergenic
927138137 2:20112262-20112284 CACCATTGCACTCCAACCTGGGG - Intergenic
927159963 2:20247563-20247585 CACCCTGGCTTACCAACCTAAGG - Intergenic
929441242 2:41967147-41967169 CACTCTTGCTCCCCAACTTGGGG + Intergenic
929670754 2:43875201-43875223 CCTACTGGCTGGCCAACCTGAGG + Exonic
932689270 2:73898635-73898657 CACCCTTGCTGGCAAAGGTATGG - Intronic
933841994 2:86295224-86295246 CTCCCGAGTTGGCCAACCTGGGG + Intronic
934529590 2:95076766-95076788 CACCCTTCCTGGCTACCCTCAGG + Intergenic
937004524 2:118499229-118499251 CACCCTGGCAGTCCAACATGTGG - Intergenic
937991141 2:127663225-127663247 CACCCTCCCTGGTCAACCTCTGG - Intronic
938406489 2:131035782-131035804 CACCCCTGCTGCACAAACTGCGG + Intronic
941046947 2:160686976-160686998 GACCTTTTCTGGTCAACCTGTGG + Intergenic
943677557 2:190731032-190731054 CACCCTTCCTGTACAGCCTGAGG + Intergenic
945261934 2:207851706-207851728 CACTCTTGTTGGCCAGGCTGGGG - Intronic
946358893 2:219207094-219207116 CACCCTTCCCTCCCAACCTGCGG - Intronic
946718882 2:222583123-222583145 GACTCCTGCTGGCCAAACTGGGG + Intronic
947216992 2:227758744-227758766 CACCATTGCACGCCAGCCTGGGG - Intergenic
947459202 2:230288303-230288325 CACCCTTAGTGTGCAACCTGTGG - Intronic
948539974 2:238684021-238684043 CATCAGTGTTGGCCAACCTGAGG + Intergenic
1172286489 20:33744249-33744271 CACTCTTGCTGCCCAGGCTGGGG - Intronic
1175881205 20:62260267-62260289 AACCCTTGCTGGCCAGACAGAGG - Intronic
1176027021 20:62990963-62990985 CACCCTGGCTGGCTGACCTGTGG + Intergenic
1176104664 20:63380340-63380362 CCCCCTTGCTCGCCATGCTGTGG + Intergenic
1176386224 21:6139764-6139786 CACTCATGCTGACCAACATGAGG - Intergenic
1176520364 21:7819572-7819594 CGCCCTTTCTGACCAAGCTGTGG - Exonic
1178654387 21:34449584-34449606 CGCCCTTTCTGACCAAGCTGTGG - Intergenic
1179286312 21:39980186-39980208 CATCCTTGATGGCCAATATGTGG - Intergenic
1179737249 21:43398488-43398510 CACTCATGCTGACCAACATGAGG + Intergenic
1180183916 21:46130224-46130246 CACCCTTCCAGCCCAACCTCTGG + Intronic
1180220385 21:46354766-46354788 CACCCTGCCTGGACACCCTGTGG - Intronic
1181011246 22:20042021-20042043 CACCATTGCACTCCAACCTGGGG - Intronic
1181559658 22:23692726-23692748 CACCACTGCTGGCGGACCTGGGG + Exonic
1182534030 22:30986587-30986609 CACCATTGCACTCCAACCTGGGG + Intergenic
1184787831 22:46680396-46680418 CTCCCTTGCTGTGTAACCTGGGG - Intergenic
1185367612 22:50444078-50444100 CAGCCATGGTGGCCACCCTGGGG + Exonic
949244015 3:1904146-1904168 CACGCGTGCTCACCAACCTGTGG + Intergenic
949437548 3:4046007-4046029 CACCACTACTGTCCAACCTGGGG + Intronic
953557982 3:43962139-43962161 CACCCTTGCACGACAAGCTGAGG - Intergenic
953713626 3:45296504-45296526 CACCGTGCCTAGCCAACCTGTGG + Intergenic
953773347 3:45796024-45796046 CACCCTTGTTGGCCAGGCTGCGG - Intronic
954081453 3:48214425-48214447 CAGGCCTCCTGGCCAACCTGGGG - Intergenic
958604785 3:96343115-96343137 CACCATTGCACTCCAACCTGGGG + Intergenic
961139658 3:124545295-124545317 CTCCTTTGCTGGCGAGCCTGAGG + Intronic
962328399 3:134455395-134455417 CACCCTGGCTGGCCAATTTTGGG + Intergenic
962679268 3:137781790-137781812 CACCATGTCTGGCCTACCTGGGG + Intergenic
962813128 3:138975601-138975623 CCGCCTGGCTGGCCAACCTGTGG - Intergenic
962825398 3:139096129-139096151 CCTCTTTGCTGGCCCACCTGAGG - Intronic
964334135 3:155636712-155636734 CACTCTTGTTGCCCAAGCTGGGG - Intronic
966724036 3:183092933-183092955 CACCATTGCACTCCAACCTGGGG - Intronic
968355998 3:198107955-198107977 AACACTTTCTGGCCAAACTGGGG + Intergenic
968356013 3:198108035-198108057 AACACTTTCTGGCCAAACTGGGG + Intergenic
968356031 3:198108124-198108146 AACACTTCCTGGCCAAACTGTGG + Intergenic
968643403 4:1726423-1726445 GCCCCCTGCTGGCCATCCTGGGG + Intronic
969293133 4:6253157-6253179 CACCCTCCCTGGCCACCCTAGGG - Intergenic
969511523 4:7620696-7620718 CAGCCTTCCAGGCCAACCTATGG - Intronic
969688283 4:8689173-8689195 CACCCCTGCTGGCAACCCCGAGG + Intergenic
972613355 4:40675480-40675502 CACCATGCCTGGCCAATCTGTGG - Intergenic
972990286 4:44815261-44815283 CACCTTTGCTGGGAATCCTGGGG + Intergenic
973616630 4:52685467-52685489 CACACTTCCTGTACAACCTGCGG - Intergenic
978052714 4:104222543-104222565 CACCATTGCACTCCAACCTGGGG - Intergenic
979556313 4:122051587-122051609 CACCATTGCAGTCCAGCCTGGGG - Intergenic
982387507 4:154826424-154826446 CACTCTTGTTGCCCAAGCTGGGG - Intronic
985060333 4:186071553-186071575 CATCCTTGCTGGCCTAGCTGTGG + Intronic
985750035 5:1668336-1668358 CAGTCTTTCTGGCCACCCTGGGG + Intergenic
986479092 5:8166473-8166495 CAACTTTGCTGGCCCACGTGTGG - Intergenic
986582957 5:9284233-9284255 AACCCTTGATTGCCTACCTGTGG - Intronic
988676026 5:33434019-33434041 CACCCTGCCTGGCCTACATGTGG - Intergenic
988932245 5:36047898-36047920 GACCCCTGCTCCCCAACCTGGGG + Intronic
994082796 5:95726888-95726910 CCCACTTACTGGTCAACCTGGGG + Intronic
997344008 5:133171708-133171730 CACCATTGCACTCCAACCTGGGG - Intergenic
997350057 5:133224674-133224696 CACACCTGCAGGCCTACCTGGGG + Intronic
997589910 5:135066238-135066260 GGCCCTTGCTGGGCAGCCTGAGG + Intronic
998690455 5:144581722-144581744 CACCATGCCTGGCCGACCTGTGG + Intergenic
1000008546 5:157210294-157210316 CATTCCTGCTTGCCAACCTGAGG + Intronic
1001533716 5:172483231-172483253 CACCATTGCACTCCAACCTGGGG - Intergenic
1002176766 5:177405051-177405073 CACCCTGGCTGGCCAGCCGCTGG + Exonic
1002758531 6:183793-183815 CTGCCATGCTGGCCCACCTGGGG - Intergenic
1002762914 6:215673-215695 CACCTTTGCTTGCCAGCCTGTGG + Intergenic
1002854175 6:1022903-1022925 CACCCTTGTGGGCCTATCTGAGG + Intergenic
1002908004 6:1466636-1466658 CACCTTTGCTGGCCAAACCAAGG - Intergenic
1002922426 6:1581946-1581968 CACCGTGCCTGGCCAACGTGGGG - Intergenic
1004006601 6:11642556-11642578 GAGCCTTCCTGGCCACCCTGTGG - Intergenic
1007757770 6:44111495-44111517 CACCCATTCTGGCCTCCCTGAGG + Intergenic
1007790343 6:44304939-44304961 GACCCCTGGTGGCCATCCTGGGG + Intronic
1008401618 6:51069836-51069858 CACTCTTGTTGCCCAAGCTGGGG + Intergenic
1009473854 6:64062647-64062669 CACCATTGCACTCCAACCTGGGG + Intronic
1010055386 6:71558369-71558391 CACCATGCCTGGCCAACCAGAGG - Intergenic
1010224340 6:73475312-73475334 CAGTCTTGTTGCCCAACCTGTGG + Intronic
1013321813 6:108999622-108999644 CACCAATGCTGGCCAAGATGTGG + Intronic
1017466272 6:154696793-154696815 AGCCCTGGGTGGCCAACCTGTGG + Intergenic
1022011424 7:26310969-26310991 CACCGTGCCTGGCCAAGCTGAGG + Intronic
1022796666 7:33737004-33737026 CACCCATGCTGGCAAAGATGTGG - Intergenic
1023835843 7:44066673-44066695 CATCCCTGCTGGCCTACCTGGGG + Intronic
1023976537 7:45034548-45034570 CACTCTTGTTGGCCAGGCTGGGG + Intronic
1024588023 7:50857873-50857895 CATACCTGCTGGCCAAACTGGGG - Intergenic
1027171477 7:75875899-75875921 CACCATTGCACTCCAACCTGGGG + Intronic
1031610491 7:123820549-123820571 CACTCTTGTTGCCCAAGCTGGGG - Intergenic
1031937982 7:127755470-127755492 TACCCTTGCCAGCCAAACTGAGG + Intronic
1032499757 7:132391615-132391637 CACCCCTGCTGGGTAGCCTGGGG - Intronic
1034261620 7:149760321-149760343 CACCGCGCCTGGCCAACCTGGGG - Intergenic
1034641016 7:152602507-152602529 CACCATGCCTGGCCAACCCGCGG - Intergenic
1034828241 7:154286731-154286753 CACTCTTCCTGGCCTCCCTGGGG + Intronic
1034958788 7:155351545-155351567 CACCTTCGCTGTCCATCCTGTGG - Intergenic
1038958956 8:32497853-32497875 CACTCTTGTTGCCCAAGCTGGGG + Intronic
1039725947 8:40216738-40216760 CACCTTTGCAGGCTAACCTTGGG - Intergenic
1039953133 8:42187688-42187710 CACCCTTGCCACCCAGCCTGTGG - Intronic
1040310932 8:46236518-46236540 CACCCTTCCAGGCCACGCTGCGG - Intergenic
1042839701 8:73111322-73111344 CACCCCTGCTAGCCATCCTTGGG - Intronic
1045906149 8:107347465-107347487 CATTCTTGCTGGTCAACCTTGGG - Intronic
1047203074 8:122782383-122782405 CTCCCTTCTTGGCCAAACTGCGG + Intronic
1047708559 8:127526615-127526637 CACCCCTGCACTCCAACCTGGGG - Intergenic
1048344772 8:133568385-133568407 CATCCCTGCTGGCACACCTGAGG - Intronic
1049457596 8:142701320-142701342 CACGCTTCCTGGACAGCCTGTGG - Intronic
1049838451 8:144755084-144755106 CTACCTGCCTGGCCAACCTGGGG + Intronic
1051579458 9:18655027-18655049 CCCCCTTGCTGGCCCATCTGAGG + Intronic
1051913807 9:22184778-22184800 CACCTTTGCTGGGGATCCTGGGG - Intergenic
1052825265 9:33169560-33169582 CACCATTGCACTCCAACCTGGGG - Intergenic
1052872882 9:33524603-33524625 CGCCCTTGATGGCCGCCCTGTGG - Exonic
1056679471 9:88704664-88704686 CAGCCCTGGGGGCCAACCTGGGG + Intergenic
1057684545 9:97221100-97221122 CGCCCTTGATGGCCACCCTGTGG + Intergenic
1061410539 9:130418892-130418914 AACCCTTGCGGGCCAGCCGGCGG + Exonic
1061875037 9:133539447-133539469 CACCCTTGCCAGCCATCCTAGGG + Intronic
1185653334 X:1665142-1665164 CACTCTTGCTGCCCAGCCAGTGG - Intergenic
1187046916 X:15655984-15656006 CACCCTAGCTGGCCGCACTGGGG + Intronic
1190258970 X:48786382-48786404 CACCCTCCCTGCCCACCCTGGGG - Intergenic
1191116857 X:56861427-56861449 AACCATTGCTGGCTAATCTGAGG + Intergenic
1191818483 X:65274978-65275000 CACTGCTGCTGGCCAGCCTGTGG - Intergenic
1191820358 X:65299874-65299896 CATCCTTACTGGGGAACCTGAGG + Intergenic
1191983902 X:66958266-66958288 CACCATTGCTCTCCAGCCTGGGG - Intergenic
1195945398 X:110205265-110205287 GACCAATTCTGGCCAACCTGTGG + Intronic
1197166034 X:123378698-123378720 CACCATTCCTGGCCAACTTGAGG + Intronic
1199909513 X:152271001-152271023 CACCATTGCAGTCCAGCCTGGGG - Intronic
1200049149 X:153419544-153419566 CAGCCTTGCTGGGCACACTGGGG - Intronic
1201975404 Y:19843440-19843462 CACTCTTGCTGCCCAGGCTGGGG + Intergenic