ID: 1069685123

View in Genome Browser
Species Human (GRCh38)
Location 10:70312989-70313011
Sequence CCACCCTTGCTGGCCAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069685123_1069685130 -6 Left 1069685123 10:70312989-70313011 CCCAGGTTGGCCAGCAAGGGTGG 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685123_1069685131 -5 Left 1069685123 10:70312989-70313011 CCCAGGTTGGCCAGCAAGGGTGG 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1069685131 10:70313007-70313029 GGTGGGCTAATGGGCATTGAGGG No data
1069685123_1069685133 -3 Left 1069685123 10:70312989-70313011 CCCAGGTTGGCCAGCAAGGGTGG 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1069685133 10:70313009-70313031 TGGGCTAATGGGCATTGAGGGGG No data
1069685123_1069685132 -4 Left 1069685123 10:70312989-70313011 CCCAGGTTGGCCAGCAAGGGTGG 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1069685132 10:70313008-70313030 GTGGGCTAATGGGCATTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069685123 Original CRISPR CCACCCTTGCTGGCCAACCT GGG (reversed) Intronic
900104421 1:976251-976273 GCAGCCTTGCTGGCCAACGTCGG - Exonic
900506398 1:3031701-3031723 CCACCCTCGCAGGCCAACTCTGG + Intergenic
901827381 1:11871028-11871050 GCACCCTTGCACTCCAACCTGGG + Intergenic
902081050 1:13820840-13820862 CCACACTTGCTGGCCACGCCAGG + Intronic
902135365 1:14300429-14300451 CCAGCCTGGCTGGGCAACATAGG - Intergenic
902272736 1:15316325-15316347 CAACCCTACCTGGCCAACGTTGG + Intronic
904482225 1:30801257-30801279 CCACCTTTGCTGGAGAACCAAGG + Intergenic
906794812 1:48688379-48688401 CCACCCTTGGTGCACCACCTGGG + Intronic
907492033 1:54814551-54814573 TCACCCTTGCTGGAGAAACTTGG - Intronic
909053893 1:70800148-70800170 CCACCGTGCCTGGCCAACATTGG + Intergenic
910337313 1:86149180-86149202 CCACCATGCCTGGCCCACCTGGG + Intronic
915100383 1:153495080-153495102 CGCCCCCTGCTGGCCAATCTTGG + Intergenic
915488747 1:156239964-156239986 GCCCCCTTGCTGGCCAGCCCAGG + Intronic
916059008 1:161086356-161086378 CCTCCCTTGCTGGCTTCCCTGGG + Intronic
916549313 1:165834420-165834442 CCACCATTGCAATCCAACCTGGG + Intronic
916816393 1:168357689-168357711 CCACCATTGCACTCCAACCTGGG - Intergenic
917254484 1:173099786-173099808 GCACCATTGCTCTCCAACCTGGG - Intergenic
918226844 1:182491569-182491591 CCTTCCTTGCTGAGCAACCTTGG - Intronic
918539777 1:185618038-185618060 GCACCATTGCTTTCCAACCTGGG + Intergenic
919621874 1:199872377-199872399 CCTCCCTTGCTGGCCATACTTGG - Intergenic
919953050 1:202383679-202383701 CCACCCTTGCACTCCAGCCTGGG + Intronic
922675209 1:227545237-227545259 CCACCCTAGTAGGCCCACCTGGG + Intergenic
923976226 1:239266544-239266566 CCACCATTGCACTCCAACCTGGG + Intergenic
1063425763 10:5948853-5948875 CCACCCTGCCCGGCCATCCTTGG + Intronic
1064058967 10:12121175-12121197 ACACCATTGCTGTCCAGCCTGGG + Exonic
1064323685 10:14329503-14329525 CTACCATTGATGGCCAACCTTGG - Intronic
1064396272 10:14984305-14984327 CCACCCTTGGTTGACATCCTGGG + Intronic
1064585256 10:16833557-16833579 ACACCCTTCCTGGCCAGGCTGGG + Intronic
1065531193 10:26671778-26671800 CCACCATTGCACTCCAACCTGGG + Intergenic
1066201876 10:33149856-33149878 ACACCATTGCTCTCCAACCTGGG - Intergenic
1068080071 10:52308954-52308976 ACTACCTGGCTGGCCAACCTAGG - Intergenic
1068697467 10:59983038-59983060 CCACCATTGCACTCCAACCTAGG - Intergenic
1069685123 10:70312989-70313011 CCACCCTTGCTGGCCAACCTGGG - Intronic
1069728499 10:70596402-70596424 CCACCCCTCCTGTCCCACCTGGG + Intergenic
1069952883 10:72031721-72031743 CTTCCCTGGCTGGGCAACCTGGG + Intergenic
1070542809 10:77428933-77428955 CCACCCCTAGTGGCCAAGCTGGG - Intronic
1070776204 10:79111289-79111311 CCTCCCTTGCCTGCCCACCTGGG - Intronic
1071129242 10:82372156-82372178 CTACTCTTGCTGGCCAACAAAGG + Intronic
1073112107 10:101068673-101068695 CCTCCCTTGCTGGACTACCAGGG - Intergenic
1073428753 10:103472259-103472281 CCACCAATTCTGGCCAACCAAGG - Intergenic
1074893566 10:117755651-117755673 CCACCCTAGCCAGCCAACCCAGG - Intergenic
1075533262 10:123248296-123248318 ACACCATTGCTCTCCAACCTGGG + Intergenic
1076108539 10:127844159-127844181 CCTCCCTTGGTAGCCACCCTGGG + Intergenic
1076217888 10:128710711-128710733 CGACCCTTGCTGGGGATCCTGGG - Intergenic
1076758290 10:132586576-132586598 CCACCCTTCCAGGCCACCCATGG - Intronic
1077076713 11:705552-705574 CCCCCCTTTCTGCCCAGCCTGGG - Intronic
1077123293 11:920891-920913 CCACCATTGCACTCCAACCTGGG - Intergenic
1077179553 11:1206159-1206181 CCACCCCTCCTGGCCCACCTTGG - Intergenic
1077649117 11:3953567-3953589 ACTTCTTTGCTGGCCAACCTAGG + Intronic
1081549970 11:44101822-44101844 CCAGCCTTGCTGCCCATTCTGGG - Intronic
1082832889 11:57632573-57632595 GCACCATTGCTCTCCAACCTGGG - Intergenic
1083236134 11:61351869-61351891 ACACCATTGCTCTCCAACCTAGG + Intronic
1083310084 11:61779553-61779575 CCTACCTTGCTGGCCACCTTGGG - Exonic
1083489294 11:63003389-63003411 CCAGGCTTGCTGGCCATGCTGGG - Intronic
1084661304 11:70548125-70548147 CAACCCCTGCCGGCCATCCTTGG - Intronic
1085717561 11:78886460-78886482 CCACCCTTGCTTCACAAGCTAGG - Intronic
1087275326 11:96155260-96155282 TCACCCTTTCTGGCCCAGCTTGG - Intronic
1089255430 11:117191539-117191561 CCACCATTGCACGCCAGCCTGGG + Intronic
1090040473 11:123286374-123286396 CCTGCTTTGCTGGCTAACCTAGG + Intergenic
1090082420 11:123622883-123622905 CTTCCCTTGCTGGCCATTCTTGG + Intronic
1094096239 12:26707815-26707837 CCACCGCGCCTGGCCAACCTGGG + Intronic
1096072548 12:48783249-48783271 CCACCCCTGCGGGCCCCCCTCGG - Exonic
1096669527 12:53190287-53190309 CGACCCCTGCTGGCCAGCATGGG + Exonic
1097218759 12:57434499-57434521 CTACCCTTGCTGGGAATCCTGGG - Intergenic
1100500307 12:95167615-95167637 ACACCATTGCAGTCCAACCTGGG - Intronic
1101753843 12:107605805-107605827 CCACCTCTGCTGCCCCACCTGGG - Intronic
1102460817 12:113098507-113098529 CAACCCCTGCTGGCCACCCTCGG + Intergenic
1102791969 12:115654283-115654305 CCACCATGCCTGGCCCACCTGGG - Intergenic
1102822038 12:115916575-115916597 CCACCACTGCTGTCCAGCCTGGG + Intergenic
1103001859 12:117390866-117390888 CCACCACGCCTGGCCAACCTTGG + Intronic
1106479791 13:30128596-30128618 GCCCCCTTGCTGGCCAGCCCAGG - Intergenic
1108560442 13:51638083-51638105 CCACCCTAGCTGCCCAACGCTGG - Intronic
1109184690 13:59254032-59254054 CCACCATTGCACTCCAACCTGGG + Intergenic
1109911696 13:68920638-68920660 GCACCCTTGCACTCCAACCTAGG + Intergenic
1110660920 13:78058866-78058888 CCATACTTGCAGGCCAACCATGG + Intergenic
1113175153 13:107555313-107555335 CCACCATTGCAGTCCAGCCTGGG - Intronic
1113969271 13:114176514-114176536 CCACCCATGCTGTCCACCCACGG - Intergenic
1113969405 13:114177111-114177133 CCACCCATGCTGTCCACCCACGG - Intergenic
1118810202 14:69267607-69267629 CCACTCTGCCTGGCCCACCTAGG - Intronic
1118839061 14:69497516-69497538 CCACCCTTGGTGACCCACCCAGG - Intronic
1120815260 14:88850399-88850421 CCACCATTCCTGGCCCATCTGGG - Intronic
1121105213 14:91274956-91274978 CCACCCTTCCTGGCCACGCAGGG + Intronic
1121320215 14:92987767-92987789 CCACCCTTGCAGGCCAGACCTGG + Intronic
1121737788 14:96230658-96230680 CCACCGTTGCACTCCAACCTAGG - Intronic
1122509555 14:102255461-102255483 CCACCCTTCCTTGCCTCCCTGGG + Intronic
1122687816 14:103518370-103518392 CCTCCCTGGCTGACCAGCCTGGG - Intergenic
1125111137 15:36036084-36036106 CCACTATGGCTGGCCGACCTTGG - Intergenic
1126109770 15:45168425-45168447 CGACCCCTGCTGGCCAACCCTGG + Intronic
1127462886 15:59215880-59215902 ACCCCCTTGCTGACCAGCCTTGG + Intronic
1130850625 15:87790309-87790331 ACTCCCTAGCTGGGCAACCTTGG + Intergenic
1132579540 16:678708-678730 CCAGACCTGCTGCCCAACCTTGG - Intronic
1132847191 16:2006025-2006047 CCTCCCGTGCTGGCCCACCCTGG - Intronic
1132885260 16:2179575-2179597 CCACCCTGGCTGGCCTACCTGGG + Exonic
1134032794 16:11006113-11006135 CTCCACTTGCTGGCCAAGCTGGG - Intronic
1135463340 16:22664016-22664038 GCACCATTGCAGTCCAACCTTGG - Intergenic
1136476916 16:30519178-30519200 CCACCATTGCACTCCAACCTGGG + Intronic
1136526413 16:30834286-30834308 TCAGCCTAGCAGGCCAACCTGGG - Exonic
1137440342 16:48493541-48493563 CCACCGTGCCTGGCCAACTTAGG - Intergenic
1137592730 16:49703674-49703696 CCACCCTTGCTGGGCCTCCCTGG - Intronic
1137904373 16:52305399-52305421 CCACCACTGCTGTCCAGCCTGGG - Intergenic
1138566877 16:57840048-57840070 CCACCTTGGCTGGCTAAGCTAGG - Intronic
1140485426 16:75289641-75289663 GCACCCTTGCTCTCCAGCCTGGG - Intergenic
1141510088 16:84506243-84506265 CCACCATTGCTGTCCACCCTTGG - Intronic
1142874976 17:2846561-2846583 CCACCATGCCTGGCCAACTTTGG + Intronic
1143533354 17:7519505-7519527 CCACCATGCCTGGCCAACTTAGG + Intergenic
1144812885 17:18012022-18012044 CCAGCCTGGCCGGCCAACATTGG - Intronic
1144858093 17:18281806-18281828 CCATCCTGCCTGGCCCACCTGGG - Intronic
1145004592 17:19330171-19330193 CCACCCCTCCAGGCCCACCTTGG - Intronic
1145272373 17:21411525-21411547 GGACCCTGGCAGGCCAACCTGGG + Intronic
1146178310 17:30680635-30680657 GCACCATTGCTCGCCAGCCTGGG - Intergenic
1146222137 17:31033464-31033486 CCACCATTGCACGCCAACCTAGG - Intergenic
1147375491 17:40020241-40020263 CCACCCCTGCTGCCGAACCTGGG - Intronic
1148632798 17:49125445-49125467 CCACTGTTCCTGGCCAAGCTTGG + Intergenic
1151169683 17:72236353-72236375 CCACCCTATCTGGCCAAAATGGG - Intergenic
1151386973 17:73760917-73760939 CCATCCTTGGTGACCTACCTGGG + Intergenic
1153683648 18:7524288-7524310 CCACTCTTGCAGGCCACCCATGG - Intergenic
1155215701 18:23641504-23641526 CCAGCCTTGCCCCCCAACCTTGG + Intronic
1156021258 18:32601924-32601946 GCACCCTTGCACTCCAACCTGGG - Intergenic
1156312851 18:35940677-35940699 CCATCATACCTGGCCAACCTGGG - Intergenic
1156576236 18:38319212-38319234 CCAGCATTGCTGCCCAATCTTGG + Intergenic
1159084018 18:63767090-63767112 CCACTCTTGCTGGATAACCATGG + Intronic
1161138731 19:2635868-2635890 CCACCGTGCCTGGCCAACTTGGG + Intronic
1161855704 19:6763704-6763726 AAGACCTTGCTGGCCAACCTTGG - Exonic
1162706663 19:12560185-12560207 CGACCCTTCCTGGCCATCCTGGG + Intronic
1163873431 19:19845323-19845345 CCACCCCGGCTGGCCAATATAGG - Intergenic
1164402690 19:27912462-27912484 CCACCCTTGTGGGCCCACCTGGG + Intergenic
1165113504 19:33515257-33515279 CCACCCTTCCTGGGCAGGCTGGG - Intronic
1165441710 19:35831899-35831921 CCACCCTTTCTGCCCACCCAAGG + Intronic
1165900176 19:39165868-39165890 CCACCCTAGCTGGGCCACCTGGG + Intronic
1166062641 19:40336251-40336273 CCACCCACTCTGGCCCACCTGGG - Intronic
1166239067 19:41477420-41477442 CCACCCTGCCTGGCCATCATGGG + Intergenic
1166832213 19:45645504-45645526 CCCCCCTTTCTGGGCATCCTGGG - Exonic
1167176927 19:47871275-47871297 CCACCGTGCCTGGCCAACCCTGG + Exonic
1167737381 19:51303909-51303931 CCACCCTATCTGGCAAAACTGGG - Intergenic
925206899 2:2014713-2014735 CCTGCCTTGCTGGCCATTCTTGG - Intronic
926152712 2:10433905-10433927 CTCCCCTTCCTGGCCCACCTGGG + Intergenic
926172507 2:10561237-10561259 CCAGCCTTGCTAGCCTCCCTGGG - Intergenic
927495528 2:23549222-23549244 CCACCCCCGCTGGGCAGCCTGGG - Intronic
929320788 2:40541499-40541521 GCACCATTGCTCTCCAACCTGGG - Intronic
929613871 2:43292889-43292911 CCACCCTTGCTGTGCAACATGGG - Exonic
929616691 2:43315503-43315525 ACACCATTGCAGTCCAACCTGGG - Intronic
930155926 2:48107606-48107628 CTACCCTTGCTGCCAAAGCTGGG + Intergenic
931764834 2:65445767-65445789 ACACCCTTGCTCTCCAGCCTGGG + Intergenic
932193691 2:69764031-69764053 CCATCGTTACTGGCCAACCTTGG + Intronic
932430913 2:71673035-71673057 CCACCCTTGCTGTCCAGCCAGGG - Intronic
932624917 2:73289937-73289959 CCACTCTTTCTGGCCACCTTGGG - Intergenic
938571815 2:132568416-132568438 CCACCGTGCCTGGCCAACCTAGG - Intronic
940136833 2:150446556-150446578 ACACCCTTGCTGTCCATCCCTGG - Intergenic
942237261 2:173922919-173922941 CTACCCTTGTGGGCTAACCTAGG - Intronic
945808898 2:214523790-214523812 GCACCCTTGCAGTCCAGCCTGGG + Intronic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
948047864 2:234957555-234957577 CTACTCTTGCTGGCCAAATTCGG - Intronic
948059613 2:235033175-235033197 CCTCCCTTGCTGGGCCACCGGGG - Intronic
948085187 2:235241446-235241468 CCATCCATGGTGGCCAACTTAGG + Intergenic
1170287829 20:14731229-14731251 AGACCTTTGCTGGCCTACCTGGG + Intronic
1170784782 20:19458060-19458082 CCACCCTGCCCTGCCAACCTAGG - Intronic
1171794946 20:29559373-29559395 CCACCCTGACTGGCTCACCTGGG + Intergenic
1171853503 20:30324892-30324914 CCACCCTGACTGGCTCACCTGGG - Intergenic
1173772354 20:45672444-45672466 CCACCATTGATGGGCACCCTAGG - Intergenic
1174589047 20:51630656-51630678 GCACCATTGCTCTCCAACCTGGG + Intronic
1175867170 20:62185065-62185087 CCACCATTGCTCTCCAACCTGGG + Intronic
1180844983 22:18976003-18976025 CCACCCTTCCTGGTCACCGTAGG + Intergenic
1181056482 22:20262741-20262763 CCACCCTTCCTGGTCACCGTAGG - Intronic
1181559657 22:23692725-23692747 CCACCACTGCTGGCGGACCTGGG + Exonic
1182340535 22:29616969-29616991 ACACCATTGCTTTCCAACCTGGG - Intronic
1182610719 22:31545320-31545342 ACACCATTGCTCTCCAACCTGGG + Intronic
1183899750 22:40996217-40996239 CCACCATTGCTCCCCAGCCTGGG - Intergenic
1183927149 22:41214359-41214381 CCACCGTGGCTGGTGAACCTTGG - Intronic
1184030912 22:41894097-41894119 CCACCCCTGCTGGCTAAACATGG + Intronic
1184109740 22:42387736-42387758 CCACCCCTCCTGGGCCACCTGGG + Intronic
1184286136 22:43472736-43472758 CCACCCTCCCTGGCCAGGCTGGG + Intronic
1184301978 22:43566822-43566844 CCACCCTTGCTTGCCTCCCTGGG - Intronic
1184951340 22:47844594-47844616 CCATCCTAGCTGCCCAGCCTCGG - Intergenic
1185367611 22:50444077-50444099 CCAGCCATGGTGGCCACCCTGGG + Exonic
950247461 3:11434420-11434442 CAACCCATGCTGGCCATCCTGGG + Intronic
950378199 3:12589517-12589539 CCACCTTTCCTGGCTAGCCTAGG - Intronic
953699245 3:45183343-45183365 CCACCCTTGCAGGCAGAGCTGGG + Intergenic
954081454 3:48214426-48214448 CCAGGCCTCCTGGCCAACCTGGG - Intergenic
954656495 3:52197400-52197422 AGCCCCTTGCTGGCCACCCTGGG - Intergenic
956735050 3:72231889-72231911 CCACCTCTGCTGTCCAACCATGG + Intergenic
957241816 3:77669895-77669917 CCACCATTGCACTCCAACCTGGG + Intergenic
957955303 3:87178566-87178588 CCACCATTGCTTTCCAGCCTGGG + Intergenic
959213714 3:103422681-103422703 CCACCCTTCTTGGCCTCCCTCGG + Intergenic
961388622 3:126538549-126538571 CCTTCCTTGCTGGCCGACCCCGG - Intronic
962328398 3:134455394-134455416 CCACCCTGGCTGGCCAATTTTGG + Intergenic
962679267 3:137781789-137781811 CCACCATGTCTGGCCTACCTGGG + Intergenic
963090203 3:141476944-141476966 CCACCGTGCCTGGCCAATCTTGG + Intergenic
966348380 3:179003487-179003509 CCATCTTTCCTGGCCAAGCTTGG + Intergenic
966550876 3:181202783-181202805 CCACCCATGCACTCCAACCTGGG - Intergenic
966754745 3:183358248-183358270 CCACCATTGCACGCCAGCCTGGG + Intronic
966970476 3:185040913-185040935 CCACCGCGCCTGGCCAACCTTGG - Intronic
968643402 4:1726422-1726444 CGCCCCCTGCTGGCCATCCTGGG + Intronic
969293134 4:6253158-6253180 ACACCCTCCCTGGCCACCCTAGG - Intergenic
969462985 4:7338552-7338574 CCACCCTGGCTGGCCCTGCTGGG - Intronic
970287190 4:14530968-14530990 GCACCATTGCTCTCCAACCTAGG + Intergenic
974401970 4:61419835-61419857 GCACCATTGCTGTCCAGCCTAGG - Intronic
977866561 4:102035359-102035381 CCACCGTGCCTGGCCAACATGGG - Intronic
979203475 4:118007196-118007218 ACAGCATTGCTAGCCAACCTTGG - Intergenic
979804065 4:124949122-124949144 TCATCCTTGCTGGCTAACCCTGG + Intergenic
980202288 4:129671249-129671271 TCACCCTTGGTTGGCAACCTAGG - Intergenic
982173421 4:152683072-152683094 CCACCATTGCAGTCCAGCCTGGG + Intergenic
982566628 4:156995274-156995296 CCATCCCTGCTGCCCAATCTGGG - Intergenic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
986073485 5:4311044-4311066 TCACCCATGCAGGGCAACCTTGG + Intergenic
993092263 5:83440966-83440988 ACTCTCTTGCTGGCCCACCTGGG - Intergenic
995303978 5:110621794-110621816 CCTCCCTTGCTGTCCAGCTTTGG + Intronic
996370546 5:122748455-122748477 CCACCTTTGCTTTCCAAACTTGG - Intergenic
996531737 5:124534257-124534279 CCACCATTGCACTCCAACCTAGG - Intergenic
998438002 5:142129866-142129888 CCACCATTGCTCTCCAGCCTGGG + Intronic
999773695 5:154794032-154794054 CCACCCCTGCTGCACACCCTTGG - Intronic
1000956854 5:167553880-167553902 CCAGCCTGCCTGGCCCACCTGGG - Intronic
1001636946 5:173217109-173217131 CCACCGTGCCTGGCCAACCATGG + Intergenic
1002922427 6:1581947-1581969 CCACCGTGCCTGGCCAACGTGGG - Intergenic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1003544628 6:7049367-7049389 CCACCATTGCACTCCAACCTGGG - Intergenic
1003774091 6:9339991-9340013 CCACCATTGCACTCCAACCTGGG - Intergenic
1004505908 6:16246489-16246511 CCACTCTTCCTTGCCAACCATGG - Intronic
1005737024 6:28757421-28757443 CCACCATTGCACTCCAACCTGGG - Intergenic
1006422826 6:33945852-33945874 CCACCATTGCACTCCAACCTGGG + Intergenic
1007158812 6:39772243-39772265 CCAATCTGCCTGGCCAACCTAGG + Intergenic
1007466683 6:42057198-42057220 CCAGCCCTGCTGGCTAATCTTGG - Intronic
1009765997 6:68076424-68076446 CCACACTTGCGGGCCAGCCATGG - Intergenic
1010106136 6:72170384-72170406 GCACCCTTGCATGCCAGCCTGGG - Intronic
1011503267 6:88013750-88013772 CCACCCCTGCTGGCAGACATGGG - Intergenic
1013283267 6:108658709-108658731 CCACCGTGCCTGGCCAACATTGG + Intronic
1013545968 6:111157567-111157589 CCACCGTGCCTGGCCAAACTTGG + Intronic
1018754323 6:166836846-166836868 GCACCCAAGCTGGCCCACCTCGG + Intronic
1019083676 6:169454629-169454651 CCCCCCTTGGTGGCCAGACTTGG + Intergenic
1019430516 7:996895-996917 CCGCCCTTGGTGGCCACCCCAGG - Intergenic
1019719066 7:2557094-2557116 CCAGCCGTGCTGGGTAACCTTGG + Intergenic
1019941527 7:4295761-4295783 CAACCCATGCTGGCCATTCTGGG + Intergenic
1020095691 7:5367713-5367735 CCACCGTGCCTGGCCAACCAAGG + Intronic
1022450580 7:30510296-30510318 TGCCCCTTGCTGGCCAACCTGGG - Intronic
1023835842 7:44066672-44066694 CCATCCCTGCTGGCCTACCTGGG + Intronic
1024063116 7:45713577-45713599 CCACCCTGACTGCCCAACCCTGG - Intronic
1024588024 7:50857874-50857896 CCATACCTGCTGGCCAAACTGGG - Intergenic
1024706986 7:51971801-51971823 CCACCCATGGTGGCCGACATGGG + Intergenic
1024863580 7:53876459-53876481 ACACCCTTACTGGCCAGGCTTGG + Intergenic
1027703992 7:81506347-81506369 CCACCCTGCCTTGTCAACCTAGG - Intergenic
1029542025 7:101189237-101189259 CCACCATTGCACTCCAACCTGGG + Intergenic
1030206442 7:106956773-106956795 CCACCATACCTGGCCAACATAGG - Intergenic
1030304634 7:108005492-108005514 CCACCATGCCTGGCCACCCTTGG - Intergenic
1032499758 7:132391616-132391638 CCACCCCTGCTGGGTAGCCTGGG - Intronic
1034261621 7:149760322-149760344 CCACCGCGCCTGGCCAACCTGGG - Intergenic
1035401717 7:158570147-158570169 CAACCCCTGCAGGCCGACCTGGG + Intronic
1037479455 8:19290443-19290465 GCACCCTCGCTTCCCAACCTCGG - Intergenic
1037931069 8:22880746-22880768 CCACCCTCACTGGTCCACCTGGG - Intronic
1039075673 8:33688780-33688802 CCACCATTGCACTCCAACCTGGG - Intergenic
1039634242 8:39145772-39145794 CCACCACTGCTTTCCAACCTGGG - Intronic
1039725948 8:40216739-40216761 GCACCTTTGCAGGCTAACCTTGG - Intergenic
1040497156 8:47976248-47976270 CCACCATTGCTCTCCAGCCTGGG + Intronic
1041776071 8:61524036-61524058 GCACCATTGCACGCCAACCTGGG + Intronic
1042839702 8:73111323-73111345 GCACCCCTGCTAGCCATCCTTGG - Intronic
1043215747 8:77584939-77584961 GCACCCTTGCACTCCAACCTGGG + Intergenic
1045906150 8:107347466-107347488 GCATTCTTGCTGGTCAACCTTGG - Intronic
1048622301 8:136147348-136147370 CCACCTTTGCTGACCTACATAGG + Intergenic
1049439369 8:142602190-142602212 CCACCCCTGGTGGACAACCTGGG + Intergenic
1050278349 9:4023938-4023960 CCACCCTTGTTTGACAACCCTGG - Intronic
1052339539 9:27351726-27351748 TTACCATTGCAGGCCAACCTTGG + Intronic
1053580324 9:39397233-39397255 CCACCATTGCACGCCAGCCTGGG + Intergenic
1053791310 9:41688190-41688212 CCACCCTGACTGGCTCACCTGGG - Intergenic
1054101911 9:60956040-60956062 CCACCATTGCACGCCAGCCTGGG + Intergenic
1054153845 9:61626582-61626604 CCACCCTGACTGGCTCACCTGGG + Intergenic
1054179658 9:61899884-61899906 CCACCCTGACTGGCTCACCTGGG - Intergenic
1054473631 9:65557702-65557724 CCACCCTGACTGGCTCACCTGGG + Intergenic
1054657880 9:67680937-67680959 CCACCCTGACTGGCTCACCTGGG + Intergenic
1055465993 9:76567070-76567092 GCACCCTTGCAGTCCAACCTGGG - Intergenic
1055756491 9:79563766-79563788 CCACCATTGCATGCCAGCCTGGG + Intergenic
1056667083 9:88589610-88589632 TCAACCTTGCTTACCAACCTTGG - Intergenic
1057093005 9:92277193-92277215 CCACCGTGCCTGGCCAAGCTGGG - Intronic
1057147360 9:92767383-92767405 CCAACCTTCCTGGCTTACCTGGG + Intergenic
1058424124 9:104862144-104862166 CCACCATTGCACTCCAACCTAGG - Intronic
1059943010 9:119376224-119376246 ACACCCTGACTGGCCAACCTTGG - Intergenic
1060597027 9:124854613-124854635 TCACCCAGGCTGGACAACCTCGG + Intronic
1060730326 9:126033126-126033148 CCACCGTGCCAGGCCAACCTTGG + Intergenic
1061489567 9:130937770-130937792 GCCCCCTTGCTGGCCAGCCCAGG + Intronic
1061875036 9:133539446-133539468 GCACCCTTGCCAGCCATCCTAGG + Intronic
1062280389 9:135749241-135749263 CTACTCTTGGTGGCCAGCCTGGG + Intronic
1190074203 X:47303709-47303731 CCATCATGCCTGGCCAACCTTGG - Intergenic
1190258971 X:48786383-48786405 CCACCCTCCCTGCCCACCCTGGG - Intergenic
1190875738 X:54458981-54459003 CCACCCTAGGTTGCCTACCTGGG + Intronic
1192083500 X:68071137-68071159 CGACCCTTCCTGGCCATTCTGGG - Intronic
1193150321 X:78118145-78118167 CGACCCTTCCTGGCCATCCTGGG + Exonic
1193276164 X:79590409-79590431 GCACCCTGGCTGGGCATCCTAGG + Intergenic
1194147072 X:90278383-90278405 CCACCCATACTAGCCAAACTAGG - Intergenic
1197222739 X:123929344-123929366 CCAGCCTTGCTCTCCAGCCTGGG - Intergenic
1198255363 X:134919549-134919571 CCACCATTGCTCTCCAGCCTGGG + Intergenic
1200049150 X:153419545-153419567 CCAGCCTTGCTGGGCACACTGGG - Intronic
1200493475 Y:3855150-3855172 CCACCCATACTAGCCAAACTAGG - Intergenic
1200845556 Y:7828923-7828945 CCACATTTGTTGGCCTACCTGGG - Intergenic