ID: 1069685125

View in Genome Browser
Species Human (GRCh38)
Location 10:70312990-70313012
Sequence CCCACCCTTGCTGGCCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069685125_1069685133 -4 Left 1069685125 10:70312990-70313012 CCAGGTTGGCCAGCAAGGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 259
Right 1069685133 10:70313009-70313031 TGGGCTAATGGGCATTGAGGGGG No data
1069685125_1069685132 -5 Left 1069685125 10:70312990-70313012 CCAGGTTGGCCAGCAAGGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 259
Right 1069685132 10:70313008-70313030 GTGGGCTAATGGGCATTGAGGGG No data
1069685125_1069685130 -7 Left 1069685125 10:70312990-70313012 CCAGGTTGGCCAGCAAGGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 259
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685125_1069685131 -6 Left 1069685125 10:70312990-70313012 CCAGGTTGGCCAGCAAGGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 259
Right 1069685131 10:70313007-70313029 GGTGGGCTAATGGGCATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069685125 Original CRISPR CCCACCCTTGCTGGCCAACC TGG (reversed) Intronic
900092554 1:926730-926752 CTAACCCTTGCTGCCCAACTAGG - Intronic
900604124 1:3516264-3516286 CCCACCCTGGGTGCCCAGCCTGG - Intronic
900647659 1:3716232-3716254 CACCCCCATGCTGGCCAGCCGGG - Intronic
900992903 1:6106178-6106200 CACCCCATTGCTGGCAAACCAGG - Intronic
901064513 1:6488579-6488601 CCCACCCTTGCTGAGTACCCAGG - Intronic
901678159 1:10898711-10898733 CCCTTCCCAGCTGGCCAACCAGG + Intergenic
901706356 1:11076461-11076483 GCCACCCCTGCTGGGCATCCAGG + Intronic
903179409 1:21597833-21597855 CCCACCCCTCCTGGCCTAGCGGG + Intronic
904535869 1:31199002-31199024 CCCACCCTTGCCAGCCAATTTGG + Intronic
905815053 1:40943593-40943615 GCCACCATGGCTGGCCAAGCAGG - Intergenic
906150232 1:43583330-43583352 ACCACCCTTGCAGGGGAACCAGG - Intronic
910803624 1:91168445-91168467 TCCACCCTGGCAGGTCAACCAGG - Intergenic
911635246 1:100228044-100228066 ACCAGCCTGGCTGGCCAACATGG - Intronic
912040499 1:105383803-105383825 GCCACCTTGGCTGGGCAACCTGG - Intergenic
916549311 1:165834419-165834441 CCCACCATTGCAATCCAACCTGG + Intronic
916816395 1:168357690-168357712 CCCACCATTGCACTCCAACCTGG - Intergenic
919699037 1:200612287-200612309 GCCACCATGCCTGGCCAACCAGG + Intronic
919953048 1:202383678-202383700 CCCACCCTTGCACTCCAGCCTGG + Intronic
920551250 1:206863124-206863146 CCCACCATTGCTCTCCAACATGG - Intergenic
921213238 1:212917149-212917171 CCCTCACTTGGTGGCCATCCCGG - Intergenic
923470062 1:234282457-234282479 CCTTCCCTTGCTGTCTAACCAGG + Intronic
923976224 1:239266543-239266565 CCCACCATTGCACTCCAACCTGG + Intergenic
924554433 1:245106841-245106863 ACCAGCCTGGCTGGCCAACATGG + Intronic
924579216 1:245309059-245309081 CTCACCCTTGATGGACAATCAGG + Intronic
924593755 1:245427576-245427598 CTCACCCTTGCTGTCCAGGCTGG - Intronic
924615010 1:245605594-245605616 CACACCCCTGCTGGAGAACCTGG + Intronic
1064058966 10:12121174-12121196 CACACCATTGCTGTCCAGCCTGG + Exonic
1065495688 10:26325376-26325398 ACCAGCCTGGCTGGCCAACAAGG - Intergenic
1065531191 10:26671777-26671799 CCCACCATTGCACTCCAACCTGG + Intergenic
1066201877 10:33149857-33149879 CACACCATTGCTCTCCAACCTGG - Intergenic
1067848697 10:49741470-49741492 ACCACCCTGGCTTGCTAACCAGG + Intronic
1069685125 10:70312990-70313012 CCCACCCTTGCTGGCCAACCTGG - Intronic
1071332195 10:84571371-84571393 CCCAGCAGTGCTGGCCAACAGGG + Intergenic
1073112109 10:101068674-101068696 CCCTCCCTTGCTGGACTACCAGG - Intergenic
1073300987 10:102470848-102470870 CCATGCCTTGCTGGCCGACCTGG + Exonic
1075533261 10:123248295-123248317 CACACCATTGCTCTCCAACCTGG + Intergenic
1076202948 10:128572805-128572827 CCCATCCTTCCTGGCCCCCCAGG + Intergenic
1076898069 10:133324164-133324186 CCCTCCCTTGCAGGCCATCAGGG + Intronic
1077123295 11:920892-920914 CCCACCATTGCACTCCAACCTGG - Intergenic
1077529096 11:3086798-3086820 CCCCCCCTGGCTGGACCACCTGG - Intergenic
1078779266 11:14421639-14421661 CCCATCCCCGCTGGGCAACCAGG - Intergenic
1080520710 11:33065769-33065791 CCGCCCTCTGCTGGCCAACCTGG + Intronic
1082832890 11:57632574-57632596 CGCACCATTGCTCTCCAACCTGG - Intergenic
1082988296 11:59186302-59186324 CACACCCAATCTGGCCAACCAGG - Intronic
1083310086 11:61779554-61779576 CCCTACCTTGCTGGCCACCTTGG - Exonic
1083738834 11:64697119-64697141 CCCACCCTTGCCCTCCGACCTGG + Intronic
1083861111 11:65420623-65420645 CTCACTCTTGTTGGCCAGCCTGG + Intergenic
1084025146 11:66443418-66443440 CCCACTGTTTCTGGCCATCCCGG - Intronic
1084980328 11:72825416-72825438 CCCTCCCCTGCCGGCCAACTTGG + Intronic
1085512230 11:77094230-77094252 ACCACCCTTGCTGAACAACTGGG - Intronic
1087008881 11:93495011-93495033 CACACCCTTGCTGACCTCCCAGG + Intronic
1088318104 11:108527794-108527816 CCCATCCTGGCTGGCAAACGTGG + Intronic
1089255428 11:117191538-117191560 CCCACCATTGCACGCCAGCCTGG + Intronic
1089507546 11:118973892-118973914 ACCAGCCTGGCTGGCCAACATGG - Intronic
1091797742 12:3306903-3306925 CCCACCCTTGCCTACCACCCAGG + Intergenic
1092848276 12:12604348-12604370 ACCAACCTGGCTGGCCAACATGG + Intergenic
1095967584 12:47879228-47879250 CCCACCCTTGCTGAGCTCCCTGG - Intronic
1096156327 12:49343226-49343248 CCCGCCCTTGCTTCCCAGCCAGG - Intergenic
1096646500 12:53040566-53040588 CCCTCCCCTACTGCCCAACCAGG - Exonic
1096669526 12:53190286-53190308 CCGACCCCTGCTGGCCAGCATGG + Exonic
1100500308 12:95167616-95167638 CACACCATTGCAGTCCAACCTGG - Intronic
1108228689 13:48317089-48317111 CCCACACTTGCTGGCGAAGAAGG - Intronic
1109184688 13:59254031-59254053 CCCACCATTGCACTCCAACCTGG + Intergenic
1109747230 13:66641073-66641095 ACCAGCCTAGCTGGCCAACATGG - Intronic
1113135450 13:107083878-107083900 CCCAACCTTGCTACCAAACCAGG - Intergenic
1113175155 13:107555314-107555336 CCCACCATTGCAGTCCAGCCTGG - Intronic
1113598272 13:111549376-111549398 CCCAGCCTTGCTGCCCCACTAGG - Intergenic
1118741441 14:68742273-68742295 CCAACCCTGGCTGCCCAGCCAGG + Intergenic
1121105211 14:91274955-91274977 CCCACCCTTCCTGGCCACGCAGG + Intronic
1121652194 14:95566750-95566772 ACCAGCCTGGCTGGCCAACATGG + Intergenic
1122340537 14:101025410-101025432 CCCACCCTTACAGGGCATCCTGG + Intergenic
1122509553 14:102255460-102255482 CCCACCCTTCCTTGCCTCCCTGG + Intronic
1122687818 14:103518371-103518393 CCCTCCCTGGCTGACCAGCCTGG - Intergenic
1122804426 14:104249415-104249437 GCCACCCTTCCTGGCAGACCAGG - Intergenic
1125322902 15:38507746-38507768 CCCACCCTTGGAGGCTAACAAGG - Exonic
1127442804 15:59027853-59027875 CCCACTCTTGTTGTCCAAGCTGG + Intronic
1129056598 15:72824646-72824668 CCCACCCTTGAAGCCCACCCAGG + Intergenic
1130196051 15:81781189-81781211 ACCTCTCTTGCTGGCCAACTTGG - Intergenic
1130884397 15:88081308-88081330 CCCACACCTGCTGGACAACCAGG + Intronic
1131225523 15:90621727-90621749 GCCACCATGCCTGGCCAACCTGG + Intronic
1132885258 16:2179574-2179596 CCCACCCTGGCTGGCCTACCTGG + Exonic
1132915245 16:2340478-2340500 CCCACCCTCGCCGGCCAGCTCGG - Intronic
1136275404 16:29176789-29176811 CCCACCCTTGTGGGCCATGCTGG - Intergenic
1136476914 16:30519177-30519199 CCCACCATTGCACTCCAACCTGG + Intronic
1137904375 16:52305400-52305422 CCCACCACTGCTGTCCAGCCTGG - Intergenic
1138387027 16:56642974-56642996 CACAGCCTAGCTGGCCCACCAGG - Intronic
1139738908 16:69017931-69017953 CTCACCCTTGTTGCCCAAGCTGG + Intronic
1139805499 16:69562392-69562414 CTCACCCTTGCTGCCCAGGCTGG + Intergenic
1140214046 16:72993195-72993217 CCCGGCCTGGCTGGCCAGCCTGG + Intronic
1140354508 16:74293814-74293836 ACCATCCTTCCTGGCCAACATGG + Intergenic
1141409791 16:83825239-83825261 CTCACCCTGGCTGGACACCCAGG - Intergenic
1142079764 16:88142854-88142876 CCCACCCTTGTGGGCCATGCTGG - Intergenic
1142730340 17:1850333-1850355 ACCAGCCTGGCTGGCCAACATGG + Intronic
1143465883 17:7135955-7135977 ACCATCCTTCCTGGCCAACATGG + Intergenic
1146178311 17:30680636-30680658 CGCACCATTGCTCGCCAGCCTGG - Intergenic
1147375493 17:40020242-40020264 CCCACCCCTGCTGCCGAACCTGG - Intronic
1147610361 17:41798382-41798404 GCCACCCTGCCTGGCCAGCCTGG - Intergenic
1148133718 17:45278310-45278332 CCCAGCCTTCCAGGCCAAGCTGG + Intronic
1149236698 17:54599551-54599573 CCCATCCTTTCTGGCCATCAAGG + Intergenic
1149683368 17:58520789-58520811 CCCATCCCTGCTGTCCCACCAGG - Exonic
1150631635 17:66884494-66884516 CTCTCCCCTGCTGCCCAACCAGG + Exonic
1151863620 17:76784696-76784718 ACCAGCCTGGCTGGCCAACATGG + Intergenic
1152144743 17:78561484-78561506 CCCACCCTTGCCCACCAGCCTGG - Intronic
1152618156 17:81347092-81347114 TCCACCCTTGCTGCCCTACAGGG - Intergenic
1152718030 17:81909174-81909196 CCCACTAGTGCTGGCCAACTGGG + Intronic
1156021259 18:32601925-32601947 CGCACCCTTGCACTCCAACCTGG - Intergenic
1157335514 18:46734404-46734426 CCCACCCCTGCTCTCCACCCTGG + Intronic
1157474458 18:48012410-48012432 CACACCCTTGTTAGCTAACCTGG - Intergenic
1158138924 18:54236192-54236214 CCGACGCGTTCTGGCCAACCTGG - Intergenic
1160518040 18:79489163-79489185 CCCACCCTCTGTGGCCCACCAGG - Intronic
1160738046 19:673723-673745 CCCACCCTCCCTGGCCAAAGGGG - Intergenic
1161001894 19:1914761-1914783 ACCACCCATGCTGGCAAAACGGG - Intronic
1161172769 19:2821285-2821307 ACCAGCCTGGCTGGCCAACATGG - Intronic
1161637504 19:5398105-5398127 CCCCGCCTTGCTGGCAAACGAGG - Intergenic
1162669324 19:12241491-12241513 ACCAGCCTTCCTGGCCAACATGG + Intronic
1162706662 19:12560184-12560206 GCGACCCTTCCTGGCCATCCTGG + Intronic
1162907212 19:13831099-13831121 CCCACCCTTGCTCTCCAATTAGG + Exonic
1163125973 19:15244399-15244421 CCCACCCTTCATTGCCACCCAGG - Exonic
1164402688 19:27912461-27912483 GCCACCCTTGTGGGCCCACCTGG + Intergenic
1164712143 19:30364472-30364494 CCCACCATTGCATGCCAACTTGG + Intronic
1165900174 19:39165867-39165889 GCCACCCTAGCTGGGCCACCTGG + Intronic
1166062643 19:40336252-40336274 CCCACCCACTCTGGCCCACCTGG - Intronic
1166859984 19:45804473-45804495 CCCACCCTTCCCGGGCAACGAGG - Exonic
925072308 2:979467-979489 CCCAGCCTTGCTGGCCATGTTGG + Intronic
925072662 2:983465-983487 CCCACCCTTCCTGCCCAACTTGG + Intronic
925969585 2:9096981-9097003 CCCACCCCTGCTGGCACAGCTGG - Intergenic
925971080 2:9107081-9107103 CATACCCTTGGTGGCCAACATGG + Intergenic
927515762 2:23670787-23670809 CCCACCCCTCCTGCCCAACCTGG - Intronic
929320789 2:40541500-40541522 CGCACCATTGCTCTCCAACCTGG - Intronic
929613873 2:43292890-43292912 GCCACCCTTGCTGTGCAACATGG - Exonic
929616692 2:43315504-43315526 CACACCATTGCAGTCCAACCTGG - Intronic
930890054 2:56374217-56374239 CCCAGCCTCACTGGCCAACAAGG - Intronic
931764833 2:65445766-65445788 CACACCCTTGCTCTCCAGCCTGG + Intergenic
932430915 2:71673036-71673058 CCCACCCTTGCTGTCCAGCCAGG - Intronic
932433009 2:71686593-71686615 CCCACCCTGGCAGGACAATCAGG - Exonic
934737851 2:96698975-96698997 CCCACCCTCCCTGACAAACCTGG + Intergenic
936392090 2:112084481-112084503 CCCACACTTGCTGCCCTTCCAGG + Intronic
937148806 2:119671895-119671917 CTCACCCTTGCAGGCCTCCCAGG + Intergenic
937977421 2:127590010-127590032 GCAACCCTTGCTGGCCTACAGGG + Intronic
944098628 2:195997309-195997331 CGGACCCATCCTGGCCAACCTGG + Intronic
945251270 2:207768219-207768241 CCCACCCTTCCAGGCCCGCCAGG - Exonic
945808897 2:214523789-214523811 CGCACCCTTGCAGTCCAGCCTGG + Intronic
948059615 2:235033176-235033198 GCCTCCCTTGCTGGGCCACCGGG - Intronic
948599317 2:239099470-239099492 CCCTCCCATGCTGGAGAACCCGG + Intronic
1173406556 20:42771276-42771298 CCCACCCTTGCTTACAAACTGGG - Intronic
1175169199 20:57068093-57068115 CCCTCCTTTGCTGGCCAAAGGGG + Intergenic
1175774168 20:61642400-61642422 CCCACACCTGCTGCCCAGCCTGG - Intronic
1175867168 20:62185064-62185086 CCCACCATTGCTCTCCAACCTGG + Intronic
1176139785 20:63539905-63539927 CCCACCCTTCCTGTGCCACCTGG + Intergenic
1176168211 20:63685556-63685578 CCCAGCCCTGCTGGGGAACCAGG - Exonic
1180763172 22:18223914-18223936 CCCACACTTGCTGGCGAAGAAGG + Intergenic
1180772474 22:18400633-18400655 CCCACACTTGCTGGCGAAGAAGG - Intergenic
1180803853 22:18650249-18650271 CCCACACTTGCTGGCGAAGAAGG - Intergenic
1180806910 22:18719200-18719222 CCCACACTTGCTGGCGAAGAAGG + Intergenic
1181217865 22:21345010-21345032 CCCACACTTGCTGGCGAAGAAGG + Intergenic
1181539427 22:23565597-23565619 CCCACTCTTCCTCTCCAACCAGG + Intergenic
1182340536 22:29616970-29616992 CACACCATTGCTTTCCAACCTGG - Intronic
1182610718 22:31545319-31545341 CACACCATTGCTCTCCAACCTGG + Intronic
1182622877 22:31627460-31627482 CCCACCCTCCCTGGCCCACCAGG + Intronic
1182651379 22:31854017-31854039 CCCACCCTTTAAGGCCCACCCGG + Intronic
1184231259 22:43159536-43159558 CCCACCCTGGCTTGCCAAATGGG - Intronic
1184235388 22:43180431-43180453 CCCACCCCTGCTGGCCTCTCCGG - Intronic
1184286134 22:43472735-43472757 CCCACCCTCCCTGGCCAGGCTGG + Intronic
1184301980 22:43566823-43566845 TCCACCCTTGCTTGCCTCCCTGG - Intronic
1184536407 22:45090420-45090442 ACCAGCCTGGCTGGCCAACATGG - Intergenic
1184980119 22:48089862-48089884 CTCAGCCTTGCTGGCCATCTTGG - Intergenic
1185367609 22:50444076-50444098 CCCAGCCATGGTGGCCACCCTGG + Exonic
1203234314 22_KI270731v1_random:141621-141643 CCCACACTTGCTGGCGAAGAAGG - Intergenic
949167424 3:959202-959224 CCCTCCCATACTGCCCAACCAGG + Intergenic
950247460 3:11434419-11434441 CCAACCCATGCTGGCCATCCTGG + Intronic
954081456 3:48214427-48214449 CCCAGGCCTCCTGGCCAACCTGG - Intergenic
961378198 3:126481073-126481095 GCCGCCCTAGCTGACCAACCTGG + Intergenic
961925393 3:130474099-130474121 CCCACACATGCTGGCCCACAAGG - Intronic
961933161 3:130554947-130554969 CCCAGCCTGGCTGCCCAACTGGG - Intergenic
963533275 3:146497472-146497494 CCCAGCAGTGCTGGCCCACCAGG + Intergenic
964985539 3:162733209-162733231 CCCACCCAAGCTTGCCAGCCTGG - Intergenic
966186151 3:177228791-177228813 CCCAGCACTGCTGGCCCACCCGG - Intergenic
966754743 3:183358247-183358269 CCCACCATTGCACGCCAGCCTGG + Intronic
969462987 4:7338553-7338575 CCCACCCTGGCTGGCCCTGCTGG - Intronic
969867988 4:10087633-10087655 CCCTTCCTTGCTGGCCACTCTGG + Intronic
971635118 4:29047694-29047716 CCCAGCAGTGCTGGCCCACCAGG + Intergenic
971704723 4:30025603-30025625 GCCAGCCTTGCTTGCCAACATGG + Intergenic
975544464 4:75547099-75547121 CGCAGACTTGCTGGACAACCAGG + Intronic
975754825 4:77562042-77562064 CCCAGCAGTGCTGGCCCACCAGG + Intronic
975877101 4:78854315-78854337 CACACCATTGCTCTCCAACCTGG - Intronic
976883994 4:89964036-89964058 ACCATCCTTCCTGGCCAACATGG - Intergenic
980390326 4:132137153-132137175 CCCACTATTGATGGGCAACCAGG - Intergenic
981847118 4:149182208-149182230 TCCACCCATGCTGGAAAACCTGG - Intergenic
982173419 4:152683071-152683093 CCCACCATTGCAGTCCAGCCTGG + Intergenic
982211505 4:153040238-153040260 CACTTCCTTCCTGGCCAACCTGG - Intergenic
983494666 4:168429344-168429366 ACCAGCCTGGCTGGCCAACGTGG - Intronic
984797305 4:183674215-183674237 ACCAGCCCTGCTGGCCAACATGG + Intronic
986325078 5:6666775-6666797 CCCAGCCTTGCTGCCCAGCCTGG + Intronic
993042605 5:82832322-82832344 CGCACCCTTGGTGTCCAACCAGG + Intergenic
996823491 5:127655635-127655657 CCCTCCCTTCCTGGCCCACAAGG + Intronic
997444474 5:133931412-133931434 CCCACCCTTGCTGTCACATCAGG - Intergenic
997901948 5:137774803-137774825 ACCAGCCTGGCTGGCCAACATGG + Intergenic
998438000 5:142129865-142129887 CCCACCATTGCTCTCCAGCCTGG + Intronic
999743984 5:154577663-154577685 CCCACCCATGCTGGGACACCGGG + Intergenic
999861601 5:155653491-155653513 CCCACCATTGATGGCCATCTAGG + Intergenic
999876166 5:155808400-155808422 CCCACCCTTGTTGGCAGACTGGG + Intergenic
1001870624 5:175151192-175151214 GCCACCTTTCCTGGCCAACTAGG + Intergenic
1002025495 5:176393880-176393902 GCGACCCTCGCTGGCCAAACAGG - Intronic
1002294872 5:178224650-178224672 CCCACTCCTTCTGGCCATCCAGG + Exonic
1003030856 6:2599288-2599310 CCCACCCTTTCTGACTAACATGG - Intergenic
1003544630 6:7049368-7049390 CCCACCATTGCACTCCAACCTGG - Intergenic
1003774093 6:9339992-9340014 CCCACCATTGCACTCCAACCTGG - Intergenic
1003776370 6:9370243-9370265 CCCACAATTTCTGTCCAACCTGG + Intergenic
1005737026 6:28757422-28757444 CCCACCATTGCACTCCAACCTGG - Intergenic
1006026624 6:31151063-31151085 CTCAGCCTTGCTGGTCAAACTGG + Exonic
1013426673 6:110018578-110018600 CCCACGCTTGCCAGCCACCCTGG + Intergenic
1015629929 6:135221995-135222017 ACCAGCCTGGCTGGCCAACATGG + Intergenic
1017187426 6:151616249-151616271 CCCAGACTTGATGGCCGACCAGG + Intronic
1017394428 6:153980066-153980088 CCCACCATTGATGGGCACCCAGG + Intergenic
1017719774 6:157236295-157236317 CCCACCCTGGCGGCCCACCCAGG + Intergenic
1017993527 6:159510566-159510588 GTCAACCTTTCTGGCCAACCTGG - Intergenic
1018671470 6:166181465-166181487 CCCACCATTGCAGTCCAGCCTGG - Intergenic
1019358707 7:594179-594201 CCCACCCAGGCTGGCCTTCCAGG + Intronic
1019455335 7:1123848-1123870 CCGACCCCTGCTGGTGAACCGGG + Intronic
1019518028 7:1448155-1448177 CCCACCCTGCCAGGCCAGCCTGG + Intronic
1021413745 7:20358247-20358269 GCCACCATTCCTGGCCTACCTGG + Intronic
1022450581 7:30510297-30510319 CTGCCCCTTGCTGGCCAACCTGG - Intronic
1023017390 7:35981764-35981786 CCCCTCCTTGCTGCCCAACCTGG + Intergenic
1023835840 7:44066671-44066693 TCCATCCCTGCTGGCCTACCTGG + Intronic
1024588026 7:50857875-50857897 CCCATACCTGCTGGCCAAACTGG - Intergenic
1029542023 7:101189236-101189258 CCCACCATTGCACTCCAACCTGG + Intergenic
1029959026 7:104669916-104669938 CCCTCCCCTACTGCCCAACCAGG - Intronic
1030568177 7:111187219-111187241 CCTTCCCTTTCTGGCCAAGCAGG + Intronic
1032504368 7:132424495-132424517 CCCACCCTTCCTGGCAAGTCAGG + Intronic
1033659096 7:143391534-143391556 CCCACCCTTCCTTGCCCACAGGG - Exonic
1035401716 7:158570146-158570168 CCAACCCCTGCAGGCCGACCTGG + Intronic
1035848526 8:2890829-2890851 CCCAACTTTTCTGGGCAACCCGG - Intergenic
1036638325 8:10566413-10566435 CCCACCCATGCTGCCAAACCAGG - Intergenic
1036693197 8:10957683-10957705 CCCATCCCTCCTGGCCATCCAGG + Intronic
1037690470 8:21177443-21177465 ACCACCCTTCCTTGCCAGCCAGG + Intergenic
1037931071 8:22880747-22880769 CCCACCCTCACTGGTCCACCTGG - Intronic
1039075675 8:33688781-33688803 CCCACCATTGCACTCCAACCTGG - Intergenic
1039880639 8:41623387-41623409 CCCACCCTTGCTGGGGTAACAGG - Exonic
1040497154 8:47976247-47976269 CCCACCATTGCTCTCCAGCCTGG + Intronic
1044906229 8:97006726-97006748 ACAACCCTTGCTGGCAACCCAGG + Intronic
1045106780 8:98900275-98900297 ACCAGCCTGGCTGGCCAACATGG - Intronic
1045265950 8:100618814-100618836 CCGCCACTTGCTCGCCAACCTGG + Intronic
1047972646 8:130098544-130098566 CCCAGCCTAGGTGGCCAACATGG - Intronic
1048344401 8:133566005-133566027 CCCATCCCTGCTGGCCAGCCAGG + Intronic
1049187685 8:141266769-141266791 CCCACACTTCCTGCCCAGCCAGG - Intronic
1049208560 8:141374778-141374800 CCCTCCCCCGCTTGCCAACCGGG - Intergenic
1049359172 8:142203855-142203877 CCCGCCCCTGCTGACCACCCTGG - Intergenic
1049359182 8:142203879-142203901 CCCGCCCCTGCTGACCACCCTGG - Intergenic
1049439367 8:142602189-142602211 CCCACCCCTGGTGGACAACCTGG + Intergenic
1049515935 8:143055793-143055815 GCCACCCTTGCTGCCCACTCAGG + Intronic
1049610989 8:143555259-143555281 CCCACCCTGCCTGGCTGACCTGG - Intronic
1050281982 9:4060046-4060068 CCCAAGGTTCCTGGCCAACCTGG + Intronic
1053580322 9:39397232-39397254 CCCACCATTGCACGCCAGCCTGG + Intergenic
1054101909 9:60956039-60956061 CCCACCATTGCACGCCAGCCTGG + Intergenic
1055465994 9:76567071-76567093 TGCACCCTTGCAGTCCAACCTGG - Intergenic
1055756489 9:79563765-79563787 CCCACCATTGCATGCCAGCCTGG + Intergenic
1057039274 9:91835685-91835707 CCCACCCCTGCTGGTCTTCCTGG - Intronic
1057773426 9:97985361-97985383 CCCACCCTCGCGGGCCCTCCGGG - Intronic
1058198473 9:102008621-102008643 CCCACCATTGGTGGCCAAGCAGG + Intergenic
1060017682 9:120100829-120100851 CCAACCCTTGCTGGCCACTGAGG + Intergenic
1061275571 9:129568103-129568125 CCCACTCTTCCTCTCCAACCAGG + Intergenic
1062033632 9:134373038-134373060 CCCTCCCCTGCTGACGAACCCGG - Intronic
1062232236 9:135487906-135487928 CCCACACTTGCTGGCAAAGAAGG + Exonic
1062280388 9:135749240-135749262 CCTACTCTTGGTGGCCAGCCTGG + Intronic
1185589545 X:1265361-1265383 ACCACGCTTCCTGGACAACCTGG + Intergenic
1186820220 X:13280446-13280468 CCCACCCTTGCCAGCCAGCAAGG + Intergenic
1187175842 X:16895663-16895685 ACCAGCCTGGCTGGCCAACATGG + Intergenic
1187285108 X:17897515-17897537 CCCATCCTTCCTTGCAAACCTGG + Intergenic
1188113209 X:26215952-26215974 CCCACCCTTACTGGCAGCCCTGG + Intergenic
1189019028 X:37315571-37315593 CCCACAATTTCTGGCCAGCCTGG + Intergenic
1192162804 X:68801242-68801264 CCCTCCCCTGCAGGCCAAACAGG - Intergenic
1193116690 X:77782550-77782572 ACCAGCCTGGCTGGCCAACATGG + Intronic
1193150320 X:78118144-78118166 GCGACCCTTCCTGGCCATCCTGG + Exonic
1196079814 X:111619312-111619334 CCCTCCCCTACTGCCCAACCAGG + Intergenic
1197012763 X:121587277-121587299 ACCAGCCTGGCTGGCCAACATGG - Intergenic
1198255361 X:134919548-134919570 CCCACCATTGCTCTCCAGCCTGG + Intergenic
1199828386 X:151523537-151523559 CCCACCCTGCCTGGCAAACAAGG - Intergenic
1200409441 Y:2846925-2846947 TACACCCTGGCTGGCCAATCTGG - Intronic
1202581605 Y:26387592-26387614 CCCACCCTTGCACTCCAGCCTGG - Intergenic