ID: 1069685130

View in Genome Browser
Species Human (GRCh38)
Location 10:70313006-70313028
Sequence GGGTGGGCTAATGGGCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069685119_1069685130 3 Left 1069685119 10:70312980-70313002 CCTCTGTGCCCCAGGTTGGCCAG No data
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685118_1069685130 6 Left 1069685118 10:70312977-70312999 CCTCCTCTGTGCCCCAGGTTGGC No data
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685125_1069685130 -7 Left 1069685125 10:70312990-70313012 CCAGGTTGGCCAGCAAGGGTGGG No data
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685123_1069685130 -6 Left 1069685123 10:70312989-70313011 CCCAGGTTGGCCAGCAAGGGTGG No data
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685115_1069685130 21 Left 1069685115 10:70312962-70312984 CCTTTGGCTTTCATTCCTCCTCT No data
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data
1069685122_1069685130 -5 Left 1069685122 10:70312988-70313010 CCCCAGGTTGGCCAGCAAGGGTG No data
Right 1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069685130 Original CRISPR GGGTGGGCTAATGGGCATTG AGG Intronic