ID: 1069686032

View in Genome Browser
Species Human (GRCh38)
Location 10:70319344-70319366
Sequence GGGCCTCACCACGTGCTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686032_1069686040 23 Left 1069686032 10:70319344-70319366 CCGGTGAGCACGTGGTGAGGCCC No data
Right 1069686040 10:70319390-70319412 AGTCATGTGTGTTGGCTGCTGGG No data
1069686032_1069686037 15 Left 1069686032 10:70319344-70319366 CCGGTGAGCACGTGGTGAGGCCC No data
Right 1069686037 10:70319382-70319404 CACCTTCAAGTCATGTGTGTTGG No data
1069686032_1069686041 24 Left 1069686032 10:70319344-70319366 CCGGTGAGCACGTGGTGAGGCCC No data
Right 1069686041 10:70319391-70319413 GTCATGTGTGTTGGCTGCTGGGG No data
1069686032_1069686039 22 Left 1069686032 10:70319344-70319366 CCGGTGAGCACGTGGTGAGGCCC No data
Right 1069686039 10:70319389-70319411 AAGTCATGTGTGTTGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686032 Original CRISPR GGGCCTCACCACGTGCTCAC CGG (reversed) Intronic
No off target data available for this crispr