ID: 1069686573

View in Genome Browser
Species Human (GRCh38)
Location 10:70322825-70322847
Sequence GTGGGACCAGCTGACCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686573_1069686588 29 Left 1069686573 10:70322825-70322847 CCTCAAAGGTCAGCTGGTCCCAC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686573_1069686575 -6 Left 1069686573 10:70322825-70322847 CCTCAAAGGTCAGCTGGTCCCAC No data
Right 1069686575 10:70322842-70322864 TCCCACCTCCCACCCAGCCAGGG No data
1069686573_1069686587 28 Left 1069686573 10:70322825-70322847 CCTCAAAGGTCAGCTGGTCCCAC No data
Right 1069686587 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
1069686573_1069686574 -7 Left 1069686573 10:70322825-70322847 CCTCAAAGGTCAGCTGGTCCCAC No data
Right 1069686574 10:70322841-70322863 GTCCCACCTCCCACCCAGCCAGG No data
1069686573_1069686584 12 Left 1069686573 10:70322825-70322847 CCTCAAAGGTCAGCTGGTCCCAC No data
Right 1069686584 10:70322860-70322882 CAGGGTCAGAGTCCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686573 Original CRISPR GTGGGACCAGCTGACCTTTG AGG (reversed) Intronic