ID: 1069686577

View in Genome Browser
Species Human (GRCh38)
Location 10:70322844-70322866
Sequence GACCCTGGCTGGGTGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686577_1069686591 28 Left 1069686577 10:70322844-70322866 CCACCTCCCACCCAGCCAGGGTC No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686577_1069686584 -7 Left 1069686577 10:70322844-70322866 CCACCTCCCACCCAGCCAGGGTC No data
Right 1069686584 10:70322860-70322882 CAGGGTCAGAGTCCTGCCTGTGG No data
1069686577_1069686587 9 Left 1069686577 10:70322844-70322866 CCACCTCCCACCCAGCCAGGGTC No data
Right 1069686587 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
1069686577_1069686590 25 Left 1069686577 10:70322844-70322866 CCACCTCCCACCCAGCCAGGGTC No data
Right 1069686590 10:70322892-70322914 CAGATGGGCACTCGCACCACAGG No data
1069686577_1069686588 10 Left 1069686577 10:70322844-70322866 CCACCTCCCACCCAGCCAGGGTC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686577 Original CRISPR GACCCTGGCTGGGTGGGAGG TGG (reversed) Intronic