ID: 1069686578

View in Genome Browser
Species Human (GRCh38)
Location 10:70322847-70322869
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686578_1069686591 25 Left 1069686578 10:70322847-70322869 CCTCCCACCCAGCCAGGGTCAGA No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686578_1069686588 7 Left 1069686578 10:70322847-70322869 CCTCCCACCCAGCCAGGGTCAGA No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686578_1069686587 6 Left 1069686578 10:70322847-70322869 CCTCCCACCCAGCCAGGGTCAGA No data
Right 1069686587 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
1069686578_1069686590 22 Left 1069686578 10:70322847-70322869 CCTCCCACCCAGCCAGGGTCAGA No data
Right 1069686590 10:70322892-70322914 CAGATGGGCACTCGCACCACAGG No data
1069686578_1069686592 29 Left 1069686578 10:70322847-70322869 CCTCCCACCCAGCCAGGGTCAGA No data
Right 1069686592 10:70322899-70322921 GCACTCGCACCACAGGAGGCAGG No data
1069686578_1069686584 -10 Left 1069686578 10:70322847-70322869 CCTCCCACCCAGCCAGGGTCAGA No data
Right 1069686584 10:70322860-70322882 CAGGGTCAGAGTCCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686578 Original CRISPR TCTGACCCTGGCTGGGTGGG AGG (reversed) Intronic