ID: 1069686579

View in Genome Browser
Species Human (GRCh38)
Location 10:70322850-70322872
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686579_1069686588 4 Left 1069686579 10:70322850-70322872 CCCACCCAGCCAGGGTCAGAGTC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686579_1069686592 26 Left 1069686579 10:70322850-70322872 CCCACCCAGCCAGGGTCAGAGTC No data
Right 1069686592 10:70322899-70322921 GCACTCGCACCACAGGAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 122
1069686579_1069686591 22 Left 1069686579 10:70322850-70322872 CCCACCCAGCCAGGGTCAGAGTC No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686579_1069686590 19 Left 1069686579 10:70322850-70322872 CCCACCCAGCCAGGGTCAGAGTC No data
Right 1069686590 10:70322892-70322914 CAGATGGGCACTCGCACCACAGG No data
1069686579_1069686587 3 Left 1069686579 10:70322850-70322872 CCCACCCAGCCAGGGTCAGAGTC No data
Right 1069686587 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686579 Original CRISPR GACTCTGACCCTGGCTGGGT GGG (reversed) Intronic