ID: 1069686580

View in Genome Browser
Species Human (GRCh38)
Location 10:70322851-70322873
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686580_1069686588 3 Left 1069686580 10:70322851-70322873 CCACCCAGCCAGGGTCAGAGTCC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686580_1069686590 18 Left 1069686580 10:70322851-70322873 CCACCCAGCCAGGGTCAGAGTCC No data
Right 1069686590 10:70322892-70322914 CAGATGGGCACTCGCACCACAGG No data
1069686580_1069686591 21 Left 1069686580 10:70322851-70322873 CCACCCAGCCAGGGTCAGAGTCC No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686580_1069686587 2 Left 1069686580 10:70322851-70322873 CCACCCAGCCAGGGTCAGAGTCC No data
Right 1069686587 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
1069686580_1069686592 25 Left 1069686580 10:70322851-70322873 CCACCCAGCCAGGGTCAGAGTCC No data
Right 1069686592 10:70322899-70322921 GCACTCGCACCACAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686580 Original CRISPR GGACTCTGACCCTGGCTGGG TGG (reversed) Intronic