ID: 1069686585

View in Genome Browser
Species Human (GRCh38)
Location 10:70322872-70322894
Sequence CTGTCAGCGGTGCCACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686585_1069686592 4 Left 1069686585 10:70322872-70322894 CCTGCCTGTGGCACCGCTGACAG No data
Right 1069686592 10:70322899-70322921 GCACTCGCACCACAGGAGGCAGG No data
1069686585_1069686594 22 Left 1069686585 10:70322872-70322894 CCTGCCTGTGGCACCGCTGACAG No data
Right 1069686594 10:70322917-70322939 GCAGGCCATTCCCCATCAGATGG No data
1069686585_1069686595 23 Left 1069686585 10:70322872-70322894 CCTGCCTGTGGCACCGCTGACAG No data
Right 1069686595 10:70322918-70322940 CAGGCCATTCCCCATCAGATGGG No data
1069686585_1069686590 -3 Left 1069686585 10:70322872-70322894 CCTGCCTGTGGCACCGCTGACAG No data
Right 1069686590 10:70322892-70322914 CAGATGGGCACTCGCACCACAGG No data
1069686585_1069686591 0 Left 1069686585 10:70322872-70322894 CCTGCCTGTGGCACCGCTGACAG No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686585 Original CRISPR CTGTCAGCGGTGCCACAGGC AGG (reversed) Intronic