ID: 1069686586

View in Genome Browser
Species Human (GRCh38)
Location 10:70322876-70322898
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686586_1069686590 -7 Left 1069686586 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
Right 1069686590 10:70322892-70322914 CAGATGGGCACTCGCACCACAGG No data
1069686586_1069686591 -4 Left 1069686586 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686586_1069686594 18 Left 1069686586 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
Right 1069686594 10:70322917-70322939 GCAGGCCATTCCCCATCAGATGG No data
1069686586_1069686595 19 Left 1069686586 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
Right 1069686595 10:70322918-70322940 CAGGCCATTCCCCATCAGATGGG No data
1069686586_1069686592 0 Left 1069686586 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
Right 1069686592 10:70322899-70322921 GCACTCGCACCACAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686586 Original CRISPR CCATCTGTCAGCGGTGCCAC AGG (reversed) Intronic