ID: 1069686588

View in Genome Browser
Species Human (GRCh38)
Location 10:70322877-70322899
Sequence CTGTGGCACCGCTGACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686583_1069686588 -5 Left 1069686583 10:70322859-70322881 CCAGGGTCAGAGTCCTGCCTGTG No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686579_1069686588 4 Left 1069686579 10:70322850-70322872 CCCACCCAGCCAGGGTCAGAGTC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686581_1069686588 0 Left 1069686581 10:70322854-70322876 CCCAGCCAGGGTCAGAGTCCTGC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686576_1069686588 11 Left 1069686576 10:70322843-70322865 CCCACCTCCCACCCAGCCAGGGT No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686577_1069686588 10 Left 1069686577 10:70322844-70322866 CCACCTCCCACCCAGCCAGGGTC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686578_1069686588 7 Left 1069686578 10:70322847-70322869 CCTCCCACCCAGCCAGGGTCAGA No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686573_1069686588 29 Left 1069686573 10:70322825-70322847 CCTCAAAGGTCAGCTGGTCCCAC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686582_1069686588 -1 Left 1069686582 10:70322855-70322877 CCAGCCAGGGTCAGAGTCCTGCC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data
1069686580_1069686588 3 Left 1069686580 10:70322851-70322873 CCACCCAGCCAGGGTCAGAGTCC No data
Right 1069686588 10:70322877-70322899 CTGTGGCACCGCTGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686588 Original CRISPR CTGTGGCACCGCTGACAGAT GGG Intronic