ID: 1069686591

View in Genome Browser
Species Human (GRCh38)
Location 10:70322895-70322917
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686579_1069686591 22 Left 1069686579 10:70322850-70322872 CCCACCCAGCCAGGGTCAGAGTC No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686578_1069686591 25 Left 1069686578 10:70322847-70322869 CCTCCCACCCAGCCAGGGTCAGA No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686582_1069686591 17 Left 1069686582 10:70322855-70322877 CCAGCCAGGGTCAGAGTCCTGCC No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686586_1069686591 -4 Left 1069686586 10:70322876-70322898 CCTGTGGCACCGCTGACAGATGG No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686580_1069686591 21 Left 1069686580 10:70322851-70322873 CCACCCAGCCAGGGTCAGAGTCC No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686577_1069686591 28 Left 1069686577 10:70322844-70322866 CCACCTCCCACCCAGCCAGGGTC No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686581_1069686591 18 Left 1069686581 10:70322854-70322876 CCCAGCCAGGGTCAGAGTCCTGC No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686576_1069686591 29 Left 1069686576 10:70322843-70322865 CCCACCTCCCACCCAGCCAGGGT No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686585_1069686591 0 Left 1069686585 10:70322872-70322894 CCTGCCTGTGGCACCGCTGACAG No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data
1069686583_1069686591 13 Left 1069686583 10:70322859-70322881 CCAGGGTCAGAGTCCTGCCTGTG No data
Right 1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type