ID: 1069686646

View in Genome Browser
Species Human (GRCh38)
Location 10:70323196-70323218
Sequence GGGCAGGTTAGACCACTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686638_1069686646 -1 Left 1069686638 10:70323174-70323196 CCACCCAGTGCCCAGGTTGTCTG 0: 1
1: 0
2: 1
3: 18
4: 273
Right 1069686646 10:70323196-70323218 GGGCAGGTTAGACCACTAGCTGG No data
1069686636_1069686646 1 Left 1069686636 10:70323172-70323194 CCCCACCCAGTGCCCAGGTTGTC 0: 1
1: 0
2: 1
3: 25
4: 422
Right 1069686646 10:70323196-70323218 GGGCAGGTTAGACCACTAGCTGG No data
1069686637_1069686646 0 Left 1069686637 10:70323173-70323195 CCCACCCAGTGCCCAGGTTGTCT 0: 1
1: 0
2: 1
3: 8
4: 338
Right 1069686646 10:70323196-70323218 GGGCAGGTTAGACCACTAGCTGG No data
1069686641_1069686646 -4 Left 1069686641 10:70323177-70323199 CCCAGTGCCCAGGTTGTCTGGGC 0: 1
1: 0
2: 2
3: 21
4: 203
Right 1069686646 10:70323196-70323218 GGGCAGGTTAGACCACTAGCTGG No data
1069686642_1069686646 -5 Left 1069686642 10:70323178-70323200 CCAGTGCCCAGGTTGTCTGGGCA 0: 1
1: 0
2: 3
3: 18
4: 211
Right 1069686646 10:70323196-70323218 GGGCAGGTTAGACCACTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686646 Original CRISPR GGGCAGGTTAGACCACTAGC TGG Intronic
No off target data available for this crispr