ID: 1069686649

View in Genome Browser
Species Human (GRCh38)
Location 10:70323209-70323231
Sequence CACTAGCTGGAGTTGAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686645_1069686649 1 Left 1069686645 10:70323185-70323207 CCAGGTTGTCTGGGCAGGTTAGA No data
Right 1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG No data
1069686642_1069686649 8 Left 1069686642 10:70323178-70323200 CCAGTGCCCAGGTTGTCTGGGCA No data
Right 1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG No data
1069686641_1069686649 9 Left 1069686641 10:70323177-70323199 CCCAGTGCCCAGGTTGTCTGGGC No data
Right 1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG No data
1069686636_1069686649 14 Left 1069686636 10:70323172-70323194 CCCCACCCAGTGCCCAGGTTGTC No data
Right 1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG No data
1069686644_1069686649 2 Left 1069686644 10:70323184-70323206 CCCAGGTTGTCTGGGCAGGTTAG No data
Right 1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG No data
1069686637_1069686649 13 Left 1069686637 10:70323173-70323195 CCCACCCAGTGCCCAGGTTGTCT No data
Right 1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG No data
1069686638_1069686649 12 Left 1069686638 10:70323174-70323196 CCACCCAGTGCCCAGGTTGTCTG No data
Right 1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686649 Original CRISPR CACTAGCTGGAGTTGAGGCT CGG Intronic