ID: 1069686937

View in Genome Browser
Species Human (GRCh38)
Location 10:70324512-70324534
Sequence TGGGTCAGCTGTGGTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069686937_1069686948 22 Left 1069686937 10:70324512-70324534 CCTGGCCAACCACAGCTGACCCA No data
Right 1069686948 10:70324557-70324579 AGAGCAGCTGCTCTGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069686937 Original CRISPR TGGGTCAGCTGTGGTTGGCC AGG (reversed) Intronic