ID: 1069687321

View in Genome Browser
Species Human (GRCh38)
Location 10:70326557-70326579
Sequence GAACCCAAGGTTCCATCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069687313_1069687321 16 Left 1069687313 10:70326518-70326540 CCTGGACTGCCTTCCATTTTTCC 0: 1
1: 0
2: 1
3: 29
4: 347
Right 1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG No data
1069687314_1069687321 7 Left 1069687314 10:70326527-70326549 CCTTCCATTTTTCCATCTTCAGG 0: 1
1: 0
2: 10
3: 62
4: 399
Right 1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG No data
1069687319_1069687321 -5 Left 1069687319 10:70326539-70326561 CCATCTTCAGGGACGTCGGAACC 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG No data
1069687317_1069687321 3 Left 1069687317 10:70326531-70326553 CCATTTTTCCATCTTCAGGGACG 0: 1
1: 0
2: 2
3: 16
4: 192
Right 1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069687321 Original CRISPR GAACCCAAGGTTCCATCAAC AGG Intronic
No off target data available for this crispr