ID: 1069687872

View in Genome Browser
Species Human (GRCh38)
Location 10:70330671-70330693
Sequence GGCATGCATCCTGATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069687861_1069687872 26 Left 1069687861 10:70330622-70330644 CCATGGGAAGGAAGCATTCCACA 0: 1
1: 0
2: 1
3: 17
4: 209
Right 1069687872 10:70330671-70330693 GGCATGCATCCTGATGGGGTGGG No data
1069687867_1069687872 -3 Left 1069687867 10:70330651-70330673 CCTTGAATTAGACAGAATGGGGC 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1069687872 10:70330671-70330693 GGCATGCATCCTGATGGGGTGGG No data
1069687863_1069687872 8 Left 1069687863 10:70330640-70330662 CCACAGAAAGGCCTTGAATTAGA 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1069687872 10:70330671-70330693 GGCATGCATCCTGATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069687872 Original CRISPR GGCATGCATCCTGATGGGGT GGG Intronic
No off target data available for this crispr