ID: 1069688241

View in Genome Browser
Species Human (GRCh38)
Location 10:70333162-70333184
Sequence GGTTGCAAGAAGTGTTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069688237_1069688241 23 Left 1069688237 10:70333116-70333138 CCTGGAAGAGGGAAGTGAAGGGA 0: 2
1: 0
2: 2
3: 44
4: 593
Right 1069688241 10:70333162-70333184 GGTTGCAAGAAGTGTTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069688241 Original CRISPR GGTTGCAAGAAGTGTTAGCT TGG Intronic
No off target data available for this crispr