ID: 1069688549

View in Genome Browser
Species Human (GRCh38)
Location 10:70334804-70334826
Sequence CAACCGCCTTGGTGCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069688549_1069688555 0 Left 1069688549 10:70334804-70334826 CCCCTCTGGCACCAAGGCGGTTG 0: 1
1: 0
2: 1
3: 5
4: 129
Right 1069688555 10:70334827-70334849 CCAGAGGTAAAGATAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069688549 Original CRISPR CAACCGCCTTGGTGCCAGAG GGG (reversed) Intronic
900137234 1:1122724-1122746 CAACACCCTTGGGGCCAGCGTGG + Intergenic
900856563 1:5189971-5189993 CAGCAGCCTTGGTCCCACAGTGG - Intergenic
903203741 1:21764678-21764700 CACCAGCCTGGGTGACAGAGTGG + Intronic
905603965 1:39280088-39280110 CTCCCGCCTAGGTGACAGAGCGG - Intronic
907113328 1:51947361-51947383 CATCAGCCTGGGTGACAGAGTGG + Intronic
909122827 1:71626135-71626157 CAAACCTCTTGGTACCAGAGTGG - Intronic
921279812 1:213555282-213555304 CAAGGGCCTTGCTGCCAGGGAGG - Intergenic
922556400 1:226535775-226535797 CAACAGCCTGGGCTCCAGAGTGG + Intergenic
924459401 1:244244914-244244936 CACCCGCCTTGGTCCCAGCATGG - Intergenic
1063592500 10:7407915-7407937 CGAGCCCCTAGGTGCCAGAGCGG + Intronic
1064472142 10:15646903-15646925 CAAACGTCTCGGTGCCAGTGAGG + Exonic
1069688549 10:70334804-70334826 CAACCGCCTTGGTGCCAGAGGGG - Intronic
1069908687 10:71747035-71747057 CAGCCTTCTTGGTGCCACAGAGG - Intronic
1072279682 10:93854454-93854476 CTACAGCCTGGGTGACAGAGGGG - Intergenic
1073112554 10:101071232-101071254 CTAACTCCTTGGTGTCAGAGGGG + Intergenic
1075448174 10:122528252-122528274 CAACAGGCTTGCTGCCAAAGTGG - Intergenic
1075464492 10:122641567-122641589 CAGCCCCCTTGGTGGCTGAGAGG + Intronic
1076876517 10:133218961-133218983 CCCCCGCCTTGGGGCCCGAGGGG - Intronic
1078066247 11:8081212-8081234 CTCCCGCCTTGGCGCCAGAGGGG + Intronic
1080289182 11:30651831-30651853 CTCCAGCCTTGGTGACAGAGTGG + Intergenic
1080615903 11:33944690-33944712 CAACCATTTTGGTGCCATAGGGG - Intergenic
1086343017 11:85866620-85866642 CTCCAGCCTTGGTGACAGAGAGG + Intronic
1087652811 11:100887982-100888004 AAACCTCCTTGCTGCCAGATGGG - Intronic
1090851024 11:130570736-130570758 CAACTGGCTTGGTGGCATAGAGG + Intergenic
1091047237 11:132335440-132335462 CAACCTCTTTGGTGCCAGTGTGG + Exonic
1095108340 12:38261615-38261637 CAACAGCCCTGCTGCCAAAGTGG - Intergenic
1096266319 12:50125537-50125559 CAACAGCCTTAGTGAAAGAGGGG - Intergenic
1098856167 12:75655568-75655590 GAACCACATTGGTACCAGAGAGG + Intergenic
1101097983 12:101363099-101363121 CTCCAGCCTGGGTGCCAGAGTGG + Intronic
1101789859 12:107916503-107916525 CACCAGCCTGGGTGACAGAGAGG + Intergenic
1102359578 12:112272863-112272885 CAGCAGCTTTGCTGCCAGAGGGG - Intronic
1103034333 12:117644131-117644153 CAGCTGCCTTGGTGCCAGTTTGG + Intronic
1103596831 12:122029357-122029379 CAACCCCCGTGGTGACAGGGTGG + Intronic
1104676326 12:130714629-130714651 CAGCCGCCTGGGGCCCAGAGTGG - Intronic
1104685391 12:130781310-130781332 CAGCAGCCTTGGTGCCACTGGGG - Intergenic
1107604903 13:42048155-42048177 CGACTGTCTTGGTGGCAGAGGGG + Intronic
1108010731 13:46006051-46006073 CACCAGCCTGGGTGACAGAGTGG + Intronic
1112494965 13:99896917-99896939 AACCCGACTGGGTGCCAGAGGGG + Exonic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1121292787 14:92791258-92791280 CAGCAGCTTTGCTGCCAGAGGGG - Intergenic
1124308750 15:28601972-28601994 CACCAGCCTGGGTGACAGAGTGG - Intergenic
1124448321 15:29760405-29760427 CTCCAGCCTTGGTGACAGAGCGG - Intronic
1125773227 15:42186407-42186429 CTCCCGCCTGGGTGACAGAGGGG + Intronic
1127586481 15:60382943-60382965 AGACCACCTTGGTGCCACAGTGG - Intronic
1128132587 15:65239097-65239119 CAGCAGCCTGGGTGACAGAGTGG + Intronic
1131474353 15:92723860-92723882 CTCCCGCCTGGGTGACAGAGTGG + Intronic
1132684178 16:1155392-1155414 CTCCCGCCTTGGTTCTAGAGAGG - Intronic
1135240989 16:20806946-20806968 CCACAGCCATGGAGCCAGAGAGG + Exonic
1140196438 16:72859387-72859409 CAACCGCTATCGTCCCAGAGAGG + Intronic
1143912302 17:10261297-10261319 TTACCGCCTTGGGGCAAGAGAGG + Intergenic
1144496939 17:15753167-15753189 CTCCAGCCTGGGTGCCAGAGTGG - Intergenic
1144606505 17:16670537-16670559 CTCCAGCCTGGGTGCCAGAGTGG - Intergenic
1144904694 17:18631741-18631763 CTCCAGCCTGGGTGCCAGAGTGG + Intergenic
1146072992 17:29701439-29701461 CTCCAGCCTTGGTGACAGAGTGG - Intronic
1148459217 17:47828623-47828645 TAACAGCCTTGGAGCCATAGCGG + Exonic
1148746862 17:49923337-49923359 CTACAGCCTGGGTGACAGAGTGG + Intergenic
1149723535 17:58869136-58869158 CACCAGCCTGGGTGACAGAGTGG + Intronic
1150865157 17:68841620-68841642 CTACAGCCTGGGTGACAGAGCGG - Intergenic
1150865162 17:68841645-68841667 CTACAGCCTGGGTGACAGAGCGG - Intergenic
1151642470 17:75405886-75405908 TAACCCTCTCGGTGCCAGAGCGG + Intergenic
1152384506 17:79963183-79963205 CTGCCGCCTGGGTGACAGAGTGG + Intronic
1152796033 17:82307170-82307192 CATCAGCCTGGGTGACAGAGTGG + Intergenic
1154937290 18:21074124-21074146 CTACAGCCCTGGTGACAGAGTGG + Intronic
1155024692 18:21930638-21930660 CTACAGCCTGGGTGACAGAGAGG - Intergenic
1161467867 19:4442182-4442204 CAGCCACCCTGGTGCCAGTGCGG - Intronic
1162790034 19:13058000-13058022 CAAGCTCCTTGGGGCCTGAGGGG + Intronic
1163915760 19:20239265-20239287 CAACAGCATGGGTTCCAGAGTGG - Intergenic
1165278931 19:34780465-34780487 CTCCAGCCTTGGTGACAGAGTGG + Intergenic
1167512681 19:49904359-49904381 CAACCGACTGGGTGCCACCGCGG - Intronic
1168680106 19:58308706-58308728 CCACTGCCTTGCTGCTAGAGTGG + Intronic
925489947 2:4380237-4380259 CAACTGCTTTGGTGCCAGCCAGG - Intergenic
928308543 2:30191272-30191294 CTACCGCCTTGGTGACAGAGCGG + Intergenic
931246165 2:60494363-60494385 CAACCTCCTTGTTTACAGAGGGG - Intronic
948519786 2:238528683-238528705 CTCCCACCTGGGTGCCAGAGTGG + Intergenic
1169003932 20:2191473-2191495 CTCCCGCCTGGGTGACAGAGTGG - Intergenic
1171495804 20:25554293-25554315 CAGCCCCCTGAGTGCCAGAGTGG + Intronic
1176390465 21:6160508-6160530 CACCAACCTTGGGGCCAGAGGGG - Intergenic
1179733002 21:43377732-43377754 CACCAACCTTGGGGCCAGAGGGG + Intergenic
1180116988 21:45714360-45714382 CAAAAGCCTTGGTGCCACACTGG + Intronic
1182844410 22:33418681-33418703 CAACAGCCAGGGGGCCAGAGTGG + Intronic
1184680687 22:46071061-46071083 CAGCCGCCTCGGTGCCAGGGCGG + Intronic
952353398 3:32562369-32562391 CTACAGCCTGGGTGACAGAGCGG - Intronic
952883618 3:38000113-38000135 CATCAGCCTTGGGGCCAGATGGG - Intronic
952907566 3:38152344-38152366 CACCAGCCTGGGTGACAGAGTGG - Intergenic
956069233 3:65430042-65430064 CATCCCCATTGGTGCCAGCGTGG - Exonic
962311020 3:134327016-134327038 CATCTTCCTTGGTCCCAGAGAGG + Intergenic
966565365 3:181374763-181374785 CAACTGGCTTTGTGGCAGAGTGG + Intergenic
968526609 4:1061280-1061302 CAGCAGCCTTGCTTCCAGAGGGG + Intronic
970588769 4:17540438-17540460 CAACCTCCCTGGTGCCAAAAAGG - Intergenic
973205439 4:47555091-47555113 CAACCCCCTTGGTTGCAGACCGG + Intronic
982590923 4:157309381-157309403 CTACAGCCTGGGTGACAGAGCGG - Intronic
986608459 5:9545613-9545635 CCAGCGCCTGGGGGCCAGAGCGG + Exonic
992966910 5:82012068-82012090 CAGCAGCCTTACTGCCAGAGAGG - Intronic
994732378 5:103507871-103507893 CACCCACCATGGTGCCAGAGGGG + Intergenic
996121645 5:119680273-119680295 TAACAGCCTTGGAGCCATAGCGG - Intergenic
998062205 5:139127664-139127686 CAACAGCCCTGGTGACAGGGAGG + Intronic
1001684174 5:173580785-173580807 CATCCCCCTTGGTGCCATCGAGG - Intergenic
1006611314 6:35296075-35296097 ACTCAGCCTTGGTGCCAGAGTGG + Intergenic
1007812199 6:44494457-44494479 CAACCGGGTTGGTGGCCGAGTGG + Intergenic
1008442541 6:51548851-51548873 CAATAGCCTTGGAGCCAGACAGG - Intergenic
1010087897 6:71942084-71942106 GCACCACCATGGTGCCAGAGTGG + Intronic
1012439460 6:99249829-99249851 CTACAGCCTGGGTGACAGAGTGG - Intergenic
1012720652 6:102738051-102738073 CAACAGTCTGGGAGCCAGAGGGG - Intergenic
1012887408 6:104861062-104861084 CTACCACCTTGTTGCCAGACTGG - Intergenic
1013454901 6:110321848-110321870 AAAGCGCTTTGCTGCCAGAGAGG + Intronic
1018323909 6:162644063-162644085 CAACCTACTTGGAGTCAGAGAGG - Intronic
1018352241 6:162971932-162971954 CGAGCGCCGTGGTGACAGAGTGG - Intronic
1020417653 7:7964640-7964662 CTACAGCCTGGGTGACAGAGTGG - Intronic
1021203209 7:17750037-17750059 CTTCAGCCTTGGTGACAGAGGGG - Intergenic
1022819493 7:33945280-33945302 CTACAGCCTGGGTGACAGAGTGG - Intronic
1023333011 7:39139284-39139306 AAACCGCCTTTGCCCCAGAGAGG + Intronic
1026454739 7:70561239-70561261 CAAGTGCCTTGGTGACAGACTGG - Intronic
1035541146 8:439245-439267 CCACCTCCTGGCTGCCAGAGGGG - Intronic
1035604496 8:920751-920773 CACCAGCCTGGGTGACAGAGCGG + Intergenic
1037799501 8:22024745-22024767 CAGCCGCCTTCCGGCCAGAGGGG + Exonic
1037984152 8:23276293-23276315 CCACCGCCTTGGCTCCAGAATGG + Intronic
1041098605 8:54373781-54373803 CTCCCGCCTGGGTGACAGAGGGG + Intergenic
1044498111 8:92915513-92915535 CTACAGCCTGGGTGACAGAGTGG - Intronic
1048862710 8:138736027-138736049 CCACCTGCTTGGTGCCAAAGAGG + Intronic
1049507031 8:143008325-143008347 CAACAGTGTTGGTGCAAGAGTGG + Intergenic
1049582774 8:143420404-143420426 CCCCCGCCATGGTGGCAGAGGGG - Intronic
1049747657 8:144269832-144269854 CCAGCGCCTTGGTGCCTGGGAGG - Intronic
1050944020 9:11495274-11495296 CATCCGACTGGCTGCCAGAGTGG - Intergenic
1051970414 9:22880493-22880515 CAACAGCCTGGGCTCCAGAGTGG - Intergenic
1055613532 9:78047984-78048006 CACCAGCCTGGGTGACAGAGTGG - Intergenic
1059165469 9:112072892-112072914 CAGCCCCCTTGGAGCCAGGGGGG + Intronic
1060422039 9:123476150-123476172 CTACAGCCTGGGTGACAGAGAGG + Intronic
1060751179 9:126170533-126170555 CAACACCCTGTGTGCCAGAGAGG + Intergenic
1062073039 9:134568638-134568660 GAACCTCCTTGGGGTCAGAGGGG - Intergenic
1062393682 9:136344015-136344037 CAGCGGTCTTGGTGCCAGTGAGG - Intronic
1186011741 X:5142245-5142267 CAAAGGCCTTGGAACCAGAGCGG - Intergenic
1187935406 X:24330978-24331000 CACCCGCCTGGGTGACAGAACGG + Intergenic
1190860539 X:54340577-54340599 CTCCAGCCTTGGTGACAGAGTGG + Intronic
1193562129 X:83031436-83031458 CACCAGCCTAGGTGACAGAGTGG - Intergenic
1200083582 X:153591784-153591806 CACCCGCTTTGGTGCCAGGGAGG + Intronic
1201235959 Y:11911903-11911925 CTACAGCCTGGGTGACAGAGCGG + Intergenic