ID: 1069689756

View in Genome Browser
Species Human (GRCh38)
Location 10:70342529-70342551
Sequence TGAGTGACACCTTGATGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689756_1069689760 17 Left 1069689756 10:70342529-70342551 CCAGTTCATCAAGGTGTCACTCA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1069689760 10:70342569-70342591 TTTCCTCATCCACAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689756 Original CRISPR TGAGTGACACCTTGATGAAC TGG (reversed) Intronic
900819688 1:4877055-4877077 TGAGTGACAAATTGAAGGACAGG + Intergenic
900972824 1:6000911-6000933 TGAGTGACGCCTTGGTGCCCTGG - Intronic
904769630 1:32873565-32873587 TGAGTGAAACCATGAGGACCTGG + Intergenic
906654588 1:47538401-47538423 TGAGTGACCCATTGATAGACTGG + Intergenic
909575423 1:77170570-77170592 TGAGTGATACAGTGGTGAACAGG - Intronic
910192110 1:84605199-84605221 TGTGTGACTCCTTGATGAATGGG - Intergenic
914870349 1:151468483-151468505 TGAGAGACAACATGGTGAACTGG + Intergenic
916923409 1:169492712-169492734 TGAATGACAACTTGAGAAACTGG - Intergenic
920093644 1:203471880-203471902 TGGGTTATACCATGATGAACAGG + Intergenic
1065788077 10:29234805-29234827 CGAGTGAGACCTGAATGAACAGG - Intergenic
1069689756 10:70342529-70342551 TGAGTGACACCTTGATGAACTGG - Intronic
1072264278 10:93712628-93712650 TCAGTTACAACTTGATGACCTGG + Intergenic
1073436347 10:103518737-103518759 TGAGTGATAACTAGATGCACAGG - Intronic
1078984843 11:16583518-16583540 TGAGTGACAACATGTAGAACAGG + Intronic
1079675473 11:23221033-23221055 TGAGTGTCACCCTGAGGAAAAGG - Intergenic
1080164798 11:29224279-29224301 TGAGTGACATCTCCATGCACAGG - Intergenic
1081487494 11:43543126-43543148 TTAGTGACACTGTGATAAACTGG + Intergenic
1083321986 11:61853655-61853677 TGAGGCAGACCTTCATGAACAGG + Intronic
1084992514 11:72940747-72940769 TGATTAACACCATGATGAACAGG - Intronic
1085715113 11:78865558-78865580 TCAGTGACACCTTCATACACTGG - Intronic
1087527959 11:99341801-99341823 TGATAGAAACCTTCATGAACAGG + Intronic
1088084354 11:105959930-105959952 TGAGTGACATCTTCCTGCACAGG - Intronic
1089892894 11:121898896-121898918 TGAGTGAGAACTGGCTGAACTGG + Intergenic
1105308409 13:19185238-19185260 TGAGTGACAACTTGAGGACAAGG + Exonic
1105435680 13:20376067-20376089 TGAGAGAGACCTTCATGCACTGG + Intergenic
1109696501 13:65967089-65967111 TGAGGGAAACTTTGATGAAATGG + Intergenic
1110094834 13:71504615-71504637 TGAGCTACAACTTGATGATCAGG - Intronic
1113532867 13:111042157-111042179 TGAGAGACCCATTGATGAAAAGG - Intergenic
1114648607 14:24269403-24269425 TGAGTGACAGGTTCAGGAACAGG + Intronic
1121409126 14:93737392-93737414 TGAGTGTCACCTGGATGAGCTGG + Intronic
1122280152 14:100617320-100617342 TGACTGTCACCTTGGTGAGCAGG + Intergenic
1131859886 15:96641251-96641273 TGAGGGTCACCTTGAGGCACGGG - Intergenic
1133898312 16:9949905-9949927 TAAGTGAGAGCTGGATGAACAGG + Intronic
1134223300 16:12372281-12372303 TGAATGACACCTTGAAGGATGGG - Intronic
1135888595 16:26336594-26336616 TTAGAGACACCTTAATGACCAGG + Intergenic
1139813082 16:69639473-69639495 TGAATGGCAATTTGATGAACTGG + Intronic
1142537781 17:631776-631798 TAAGTGACAGGTTGATGAGCAGG + Intronic
1153113240 18:1619715-1619737 TGAGTGACTCCATTTTGAACAGG - Intergenic
1153520936 18:5953271-5953293 TGAGTGACACCTAGAAGAGTGGG + Intergenic
1153676306 18:7458681-7458703 TGAGTGAGAGTTTGATGAAAGGG + Intergenic
1154969652 18:21394629-21394651 TTGGTGACTCCTAGATGAACGGG - Intronic
1155015982 18:21840046-21840068 TGAGTGACTCATTGATTGACTGG - Intronic
1155252209 18:23963523-23963545 CTAGTGACATCTTGATGAAAAGG - Intergenic
1159651524 18:70984334-70984356 TGAGAAACACCTGGATGACCAGG - Intergenic
1160151668 18:76399891-76399913 TGAGTGACATGTGGATGAAATGG + Intronic
1160306343 18:77742361-77742383 TGTCTGATACCTTGATGAATTGG - Intergenic
1160981966 19:1820299-1820321 TGAGACACTCCTCGATGAACAGG + Exonic
928260196 2:29759737-29759759 TGATAGGCACCATGATGAACAGG + Intronic
930445359 2:51464072-51464094 TGAGAGACACCGTGATAGACAGG - Intergenic
930928999 2:56858122-56858144 TTAATCACACCTAGATGAACTGG - Intergenic
931135019 2:59389147-59389169 TGGGTGACACCTTTATTATCAGG + Intergenic
931789731 2:65654221-65654243 TGAGTGGCACCTCCATGAAAGGG - Intergenic
936281953 2:111149300-111149322 TTAGTGACAGCTTAATGAAAGGG + Intronic
938136725 2:128765419-128765441 TGAGTGACATCTCCAGGAACGGG - Intergenic
938299823 2:130202328-130202350 TGAGTGACAACTTGAGGACAAGG + Intergenic
938456887 2:131472157-131472179 TGAGTGACAACTTGAGGACAAGG - Intronic
939544226 2:143533143-143533165 TGAGTGACAGGATGATGAGCAGG + Intronic
942752764 2:179306612-179306634 TGAGTGCCACCTTCATGAATGGG + Intergenic
944422229 2:199543797-199543819 TCAGCGACACTTTGATGACCTGG - Intergenic
945485485 2:210390511-210390533 TCAGTGACACCTTAATAAAAAGG + Intergenic
945720777 2:213416066-213416088 TGAGTGATAACCTGATGAGCAGG + Intronic
1170721918 20:18888923-18888945 TGAGTGACAGCTTTATGCACAGG - Intergenic
1170743132 20:19075326-19075348 TGAGTGGCACCTTGCAGCACTGG + Intergenic
1178101563 21:29274185-29274207 TCAGTGACACATTGATATACAGG - Intronic
1180109915 21:45643007-45643029 TGAGCGAGACCTTGGTGGACGGG - Intergenic
958564792 3:95796179-95796201 TGAGAGACACGTGAATGAACAGG - Intergenic
961022997 3:123525347-123525369 AGTGTGACACCTTGATCAGCAGG - Intronic
964037218 3:152214161-152214183 TGAGTGACAGCATGATAAACTGG + Intergenic
964831310 3:160886532-160886554 TGAGTGACACCTCCAGGCACAGG + Intronic
965278572 3:166719479-166719501 TGAGTGAGAACCTGATGAAAAGG - Intergenic
966952388 3:184833492-184833514 TGAAGGACACATTGTTGAACAGG - Intronic
969307229 4:6332780-6332802 GGAGTGACACGGTGAGGAACCGG + Intronic
970288028 4:14539745-14539767 TGAGTGACATCTTCAGGCACGGG + Intergenic
974057383 4:56997724-56997746 TGAGTGACAAGTAGATGATCAGG + Intronic
975302696 4:72809379-72809401 TGAGTCACTCCTTGAAGGACTGG - Intergenic
980493584 4:133561333-133561355 TGAATGACACCTTGAAGAGTTGG - Intergenic
982718194 4:158830822-158830844 CTAGTGACACAATGATGAACAGG - Intronic
984071728 4:175122486-175122508 TGAATAACACCTGGGTGAACAGG + Intergenic
986257602 5:6113507-6113529 TGAGGGCCACCTTGATGGACGGG + Intergenic
987590324 5:19916915-19916937 TCAGTGACATCTTGATTAATGGG - Intronic
989780862 5:45263081-45263103 TGAGGGCCACCTTGAAGAATGGG + Intronic
992764498 5:79984735-79984757 TGAGAGAAACATTGAGGAACTGG - Intronic
994419103 5:99510091-99510113 TAAGTGACACCTTGAGCTACAGG + Intergenic
994633136 5:102310513-102310535 TGGGTGAAAGATTGATGAACAGG + Intergenic
995716639 5:115087210-115087232 AGAGTGGCACCTTTATGAATTGG + Intergenic
996749540 5:126874939-126874961 GGAGTCACACTTTGAGGAACCGG + Intronic
999141414 5:149364897-149364919 GGAGTGACAGCTTGGTGAACAGG - Intronic
1001048021 5:168390558-168390580 TGGGTCACACCTTGTTTAACTGG - Intronic
1001704956 5:173734934-173734956 TGAGAGAGACCATGAGGAACAGG - Intergenic
1004661726 6:17716642-17716664 TGAGTGATACCTTGCAGAAATGG + Intergenic
1007816117 6:44526829-44526851 TTAGTTACACCTTAATGAATGGG + Intergenic
1015031777 6:128603932-128603954 TGGATCACACCTTGATGATCAGG + Intergenic
1015944068 6:138482252-138482274 GGAGTGTCACCATGTTGAACAGG - Intronic
1016239359 6:141910587-141910609 AGAGTGGCACCTTCATGAATAGG - Intergenic
1018550974 6:164998378-164998400 TGACAGACACCTTGAGGAACAGG + Intergenic
1023566027 7:41524429-41524451 TGAGTCAAACCTTGATGCCCAGG - Intergenic
1023654142 7:42403029-42403051 GGAGTGAGACCTTTATCAACTGG + Intergenic
1025116663 7:56264023-56264045 TAAGTGACATCTTGATGTTCTGG - Intergenic
1026201224 7:68216152-68216174 TAAGTGACATCTTGATGTGCTGG - Intergenic
1026274429 7:68864228-68864250 AGAGTGACTCCATGTTGAACAGG - Intergenic
1028049003 7:86158952-86158974 TGAGTGACATCTTCAGGCACAGG + Intergenic
1030701472 7:112646419-112646441 TGAGTGACATCTTCAGGCACAGG - Intergenic
1031154514 7:118094251-118094273 GCAGTGACACCTTGTAGAACAGG - Intergenic
1031900970 7:127410218-127410240 TGACTGACACTTAGTTGAACAGG + Intronic
1034085442 7:148318056-148318078 TGAATGAGACTTTGATGAAAGGG - Intronic
1034818995 7:154199272-154199294 TGAGTGACAACATGAGGAGCAGG - Intronic
1036773613 8:11595068-11595090 TGAGTAACACCCTGGTAAACAGG + Intergenic
1037605765 8:20435865-20435887 TCAGTGCCACCTTGAGAAACAGG - Intergenic
1039685828 8:39801333-39801355 TGAGTGACATCTCCATGCACAGG - Intronic
1043121186 8:76326644-76326666 TGAATGACAGAGTGATGAACTGG + Intergenic
1044206688 8:89499104-89499126 TCAGTGACAGCTTGATCAAGAGG + Intergenic
1045321805 8:101087327-101087349 TGAGTGAGACCCTGAAGAAAAGG - Intergenic
1047390652 8:124448063-124448085 TGAGAGAGATCTTGTTGAACTGG - Intergenic
1051162140 9:14220730-14220752 GAAGTTACACCTTGATGAAGGGG - Intronic
1052401652 9:28007883-28007905 TGAGTGACACCGTGGTAAAATGG - Intronic
1053729935 9:41043529-41043551 TGTCTGACACCTTGATTTACTGG - Intergenic
1054847670 9:69814272-69814294 TGAGTAACATCTTGAGGTACAGG - Intergenic
1058511259 9:105720489-105720511 TGAGTGGCACCTTGAAGAGTAGG + Intronic
1059778004 9:117495643-117495665 TGTTTGAGACCTTGAAGAACAGG - Intergenic
1059976774 9:119725986-119726008 TCATTGCCACCTTGATGGACTGG + Intergenic
1203786175 EBV:129091-129113 TGAATGTCACATTGATGAGCGGG + Intergenic
1186489619 X:9961303-9961325 GGACTGACACCTGGATGAGCAGG + Intergenic
1186548666 X:10478972-10478994 TAAGTGACAGGTTGATGAATAGG + Intronic
1186753745 X:12648386-12648408 TGAGTTGGATCTTGATGAACGGG - Intronic
1192921018 X:75706374-75706396 GGAGTTTCACCTTGATGACCAGG - Intergenic
1197650329 X:129057029-129057051 TAAGTCACACCTTGAGGAAAAGG - Intergenic
1198571142 X:137958513-137958535 TGAGTCACACCTTGAGTAAATGG + Intergenic
1199018204 X:142845145-142845167 TGAGTTACACCTTGGTGAGGAGG + Intergenic
1199372014 X:147060584-147060606 TGATTGACACCTAGAGCAACTGG - Intergenic
1201325290 Y:12749564-12749586 TGTGTGACTCCTTGATGGATGGG + Intronic