ID: 1069689756

View in Genome Browser
Species Human (GRCh38)
Location 10:70342529-70342551
Sequence TGAGTGACACCTTGATGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689756_1069689760 17 Left 1069689756 10:70342529-70342551 CCAGTTCATCAAGGTGTCACTCA No data
Right 1069689760 10:70342569-70342591 TTTCCTCATCCACAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689756 Original CRISPR TGAGTGACACCTTGATGAAC TGG (reversed) Intronic