ID: 1069689757

View in Genome Browser
Species Human (GRCh38)
Location 10:70342556-70342578
Sequence GATGAGGAAACTGAGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8520
Summary {0: 60, 1: 436, 2: 1255, 3: 2528, 4: 4241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689757_1069689765 19 Left 1069689757 10:70342556-70342578 CCCTGAGCCTCAGTTTCCTCATC 0: 60
1: 436
2: 1255
3: 2528
4: 4241
Right 1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG No data
1069689757_1069689766 20 Left 1069689757 10:70342556-70342578 CCCTGAGCCTCAGTTTCCTCATC 0: 60
1: 436
2: 1255
3: 2528
4: 4241
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data
1069689757_1069689760 -10 Left 1069689757 10:70342556-70342578 CCCTGAGCCTCAGTTTCCTCATC 0: 60
1: 436
2: 1255
3: 2528
4: 4241
Right 1069689760 10:70342569-70342591 TTTCCTCATCCACAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689757 Original CRISPR GATGAGGAAACTGAGGCTCA GGG (reversed) Intronic
Too many off-targets to display for this crispr