ID: 1069689758

View in Genome Browser
Species Human (GRCh38)
Location 10:70342557-70342579
Sequence GGATGAGGAAACTGAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6725
Summary {0: 7, 1: 123, 2: 745, 3: 1942, 4: 3908}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689758_1069689766 19 Left 1069689758 10:70342557-70342579 CCTGAGCCTCAGTTTCCTCATCC 0: 7
1: 123
2: 745
3: 1942
4: 3908
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data
1069689758_1069689765 18 Left 1069689758 10:70342557-70342579 CCTGAGCCTCAGTTTCCTCATCC 0: 7
1: 123
2: 745
3: 1942
4: 3908
Right 1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689758 Original CRISPR GGATGAGGAAACTGAGGCTC AGG (reversed) Intronic
Too many off-targets to display for this crispr